Prev. |  KEGG KO K06689 > 

RIKEN DNA Bank Human Resource - UBE2D2

Gene ID NCBI Gene 7322 |  KEGG hsa:7322
Gene Symbol UBE2D2
Protein Name ubiquitin conjugating enzyme E2 D2
Synonyms E2(17)KB2|PUBC1|UBC4|UBC4/5|UBCH4|UBCH5B
Ortholog resources KEGG ortholog (KEGG orthology K06689) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY028812 IRAK072A12 pBluescriptR BC033349 NM_181838 Full
HGY042482 IRAK106D10 pBluescript BC048426 NM_181838 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR048100 ARe20E04 pKA1U5 NM_003339.2  
GGCGCGCGCGTCCCTCGGTCCACCTGCAGCAGGGAGGAAGACAGGCAATCCCTCCGGCTG
HKR165773 ARi14H05 pGCAP10 NM_003339.2  
GCCCTCGGTCCACCTGCAGCAGGGAGGAAGACAGGCAATCCCTCCGGCTGTCCGACCAAG
HKR420560 RBdS051G16 pGCAP10 NM_003339.2  
GGCAGCTACGGCGGCGGCGGCGGTGGCGGCTAGGGCGGCGGCGAATAAAGGGGCCGCCGC
HKR430134 RBdS075F14 pGCAP10 NM_003339.2  
GAGAGGCAGCTACGGCGGCGGCGGCGGTGGCGGCTAGGGCGGCGGCGAATAAAGGGGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl