Prev. |  KEGG KO K10573 > 

RIKEN DNA Bank Human Resource - UBE2A

Gene ID NCBI Gene 7319 |  KEGG hsa:7319
Gene Symbol UBE2A
Protein Name ubiquitin conjugating enzyme E2 A
Synonyms HHR6A|MRXS30|MRXSN|RAD6A|UBC2
Ortholog resources KEGG ortholog (KEGG orthology K10573) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY031176 IRAK077P16 pBluescriptR BC042021 NM_181777 Full/var
HGY091212 IRAL028A12 pOTB7 BC010175 NM_181777 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE023219 W01A058A19 pENTR-TOPO IRAL028A12 BC010175 NM_181777  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR169350 ARi23G06 pGCAP10 NM_003336.2  
TGAGCCTCTTCGGCCTCCTCGCCCGCCGCGGGAACCCGAGACCCCAGTGTATGCCCCACC
HKR186430 ARi66B06 pGCAP10 NM_003336.2  
GACCGACCCTCGACTTCGGAGAGGCAGCGCGGTTCCTCTGGGTGCTTCCGCCTCCCCTTC
HKR332901 RBb32E05 pGCAP1 NM_003336.2  
TGCCAGACCGACCCTCGACTTCGGAGAGGCAGCGCGGTTCCTCTGGGTGCTTCCGCCTCC
HKR371745 RBd29G01 pGCAP10 NM_003336.2  
GACCGACCCTCGACTTCGGAGAGGCAGCGCGGTTCCTCTGGGTGCTTCCGCCTCCCCTTC
HKR385354 RBd63G10 pGCAP10 NM_003336.2  
GACCGACCCTCGACTTCGGAGAGGCAGCGCGGTTCCTCTGGGTGCTTCCGCCTCCCCTTC
HKR442155 RBdS105G11 pGCAP10 NM_003336.2  
GTTCGGAGAGGCAGCGCGGTTCCTCTGGGTGCTTCCGCCTCCCCTTCTCCTGCTTCTCCA
HKR444362 RBdS110P02 pGCAP10 NM_003336.2  
CGGCCGGCCGATGAGACCGACCCTCGACTTCGGAGAGGCAGCGCGGTTCCTCTGGGTGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl