Prev. |  KEGG KO K03178 > 

RIKEN DNA Bank Human Resource - UBA1

Gene ID NCBI Gene 7317 |  KEGG hsa:7317
Gene Symbol UBA1
Protein Name ubiquitin like modifier activating enzyme 1
Synonyms A1S9|A1S9T|A1ST|AMCX1|CFAP124|GXP1|POC20|SMAX2|UBA1A|UBE1|UBE1X
Featured content Parkinson disease - human
Ortholog resource in our bank

  UBA1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084708 IRAL011M20 pOTB7 BC013041 NM_153280
HGY096333 IRAL040N21 pOTB7 BC020261 NM_153280 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE081218 M01C003A18 pDONR221 04-134-2_2-B09 BC013041 NM_153280  
HGE081266 M01C003C18 pDONR221 04-134-2_2-B09 BC013041 NM_153280  
HGE081314 M01C003E18 pDONR221 04-134-2_2-B09 BC013041 NM_153280  
HGE081362 M01C003G18 pDONR221 04-134-2_2-B09 BC013041 NM_153280  
HGE081410 M01C003I18 pDONR221 04-134-2_2-B09 BC013041 NM_153280  
HGE081458 M01C003K18 pDONR221 04-134-2_2-B09 BC013041 NM_153280  
HGE081506 M01C003M18 pDONR221 04-134-2_2-B09 BC013041 NM_153280  
HGE081554 M01C003O18 pDONR221 04-134-2_2-B09 BC013041 NM_153280  
HGE098027 M01C045B03 pDONR221 MGC12-C02 BC013041 NM_153280  
HGE098075 M01C045D03 pDONR221 MGC12-C02 BC013041 NM_153280  
HGE098123 M01C045F03 pDONR221 MGC12-C02 BC013041 NM_153280  
HGE098171 M01C045H03 pDONR221 MGC12-C02 BC013041 NM_153280  
HGE098219 M01C045J03 pDONR221 MGC12-C02 BC013041 NM_153280  
HGE098267 M01C045L03 pDONR221 MGC12-C02 BC013041 NM_153280  
HGE098315 M01C045N03 pDONR221 MGC12-C02 BC013041 NM_153280  
HGE098363 M01C045P03 pDONR221 MGC12-C02 BC013041 NM_153280  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR042579 ARe06H11 pKA1U5 NM_003334.3  
GATCTTGTGTCGGCGGCTCGGCTGTAAGGAGGTGGCAGGGACAACCACAACCACAACGGC
HKR218126 ARiS045F06 pGCAP10 NM_003334.3  
NNCNTGTGTCGGCGGCTCGGCTGTAAGGAGGTGGCANGNACAACCACAACCACAACGGCC
HKR238635 ARiS096J19 pGCAP10 NM_003334.3  
GATCTTGTGTCNGCGGCTCGGCTGTAAGGAGGTGGNANGGACAACCACAACCACAANGGC
HKR279310 ARiS198E14 pGCAP10 NM_003334.3  
GATCTTGTGTCGGCGGCTCGGCTGTAAGGAGGTGGCAGGGACAACCACAACCACAACGGC
HKR347249 RBb68C01 pGCAP1 NM_003334.3  
GGTCGGCGGCTTCGGCTTGTAAGGAAGGTGGCAGGGACAACCACAACCACAACGGCCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl