Prev. |  KEGG KO K04551 > 

RIKEN DNA Bank Human Resource - UBB

Gene ID NCBI Gene 7314 |  KEGG hsa:7314
Gene Symbol UBB
Protein Name ubiquitin B
Synonyms HEL-S-50
Ortholog resources KEGG ortholog (KEGG orthology K04551) in the DNA Bank
Featured content Parkinson disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX032831 IRAK082B07 pCMV-SPORT6 BC038999 NM_018955 Full
HGX042812 IRAK107A12 pCMV-SPORT6 BC046123 NM_018955 Full
HGY080464 IRAL001C16 pOTB7 BC000379 NM_018955 Full
HGY090561 IRAL026G17 pOTB7 BC009301 NM_018955 Full
HGY092501 IRAL031E05 pDNR-LIB BC015127 NM_018955 Full
HGY094286 IRAL035L22 pDNR-LIB BC026301 NM_018955 Full
HGY096661 IRAL041K21 pDNR-LIB BC031027 NM_018955 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE082830 M01C007B06 pDONR221 FLJ01-D03 AK129498 NM_018955  
HGE082878 M01C007D06 pDONR221 FLJ01-D03 AK129498 NM_018955  
HGE082926 M01C007F06 pDONR221 FLJ01-D03 AK129498 NM_018955  
HGE082974 M01C007H06 pDONR221 FLJ01-D03 AK129498 NM_018955  
HGE083022 M01C007J06 pDONR221 FLJ01-D03 AK129498 NM_018955  
HGE083070 M01C007L06 pDONR221 FLJ01-D03 AK129498 NM_018955  
HGE083118 M01C007N06 pDONR221 FLJ01-D03 AK129498 NM_018955  
HGE083166 M01C007P06 pDONR221 FLJ01-D03 AK129498 NM_018955  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041607 ARe04A07 pKA1U5 NM_018955.2  
GAAGGGGCGGCTTGGCTTTGTTGGGTGAGCTTGTTTGTGTCCCTGTGGGTGGACCNGCTT
HKR063748 ARe59G04 pKA1U5 NM_018955.2  
TTGAGGGGCGGTTGGCTTTGTTGGGTGAGCTTNTTTGTGTCCCTGTGGGTGGACGTGGTT
HKR068103 ARe70E07 pKA1U5 NM_018955.2  
ATTTAGGGGCGGTTGGCTTTGTTGGGTGAGCTNGTTTGTGTCCCTGTGGGTGGACGTGGT
HKR079628 ARe99B04 pKA1U5 NM_018955.2  
GAGGGGCGGTTGGCTTTGTTGGGTGAGCTTGTTTGTGTCCCTGATGGGTGGACGTGGTTG
HKR082411 ARf06A11 pKA1U5 NM_018955.2  
ATTTAGGGGCGGTTGGCTTTGTTGGGTGAGCTTGTTTGTGTCCCTGNTGGGTGGACGTGG
HKR167635 ARi19B11 pGCAP10 NM_018955.2  
GATTTTAGGGGCGGTTGGCTTTGTTGGGTGAGCTTGTTTGTGTCCCTGTGGGTGGACGTG
HKR173604 ARi34A04 pGCAP10 NM_018955.2  
GAGGGGCGGTTGGCTTTGTTGGGTGAGCTTGTTTGTGTCCCTGTGGGTGGACGTGGTTGG
HKR176901 ARi42E05 pGCAP10 NM_018955.2  
GAGGGGCGGTTGGCTTTGTTGGGTGAGCTTGTTTGTGTCCCTGTGGGTGGACGTGGTTGG
HKR185301 ARi63E05 pGCAP10 NM_018955.2  
GAGGGGCGGTTGGCTTTGTTGGGTGAGCTTGTTTGAGAAATATNTGGTGGAANCCCNCCG
HKR205357 ARiS013G13 pGCAP10 NM_018955.2  
GAGGGGCGGTTGGCTTNGTTGGGTGAGCTTGTTTGTGTCCCTGTGGGTGGACGTGGTTGG
HKR208044 ARiS020B20 pGCAP10 NM_018955.2  
TGAGGGGCGGTTGGCTTTGTTGGGTGAGCTTGTTTGTGTCCCTGTGGGTGGACGTGGTTG
HKR218281 ARiS045L17 pGCAP10 NM_018955.2  
GAGGGGCGGTTGGCTTTGTTGGGTGAGCTTGTTTGTGTCCCTGTGGGTGGACGTGGTTGG
HKR235250 ARiS088C02 pGCAP10 NM_018955.2  
GGTTGCATAAATTTGCGCTCCGCCAGCCCGGAGCATTTAGGGGCGGTTGGCTTTGTTGGG
HKR247465 ARiS118L01 pGCAP10 NM_018955.2  
GATTTTTTTTAGGGGCGGTTGGCTTTGTTGGGTGAGCTTGTTTGTGTCCCTGTGGGTGGA
HKR260286 ARiS150L22 pGCAP10 NM_018955.2  
GATTTAGGGGCGGTTGGCTTTGTTGGGTGAGCTTGTTTGTGTCCCTGTGGGTGGACGTGG
HKR264652 ARiS161K12 pGCAP10 NM_018955.2  
GAGGGGCGGTTGGCTTTGTTGGGTGAGCTTGTTTGTGTCCCTGTGGGTGGACGTGGTTGG
HKR279469 ARiS198L05 pGCAP10 NM_018955.2  
GAGGGGCGGTTGGCTTTGTTGGGTGAGCTTGTTTGTGTCCCTGTGGGTGGACGTGGTTGG
HKR324460 RBb11C12 pKA1U5 NM_018955.2  
ATCCTGTGATTTTTAGGGGCGGTTGGCTTTGTTGGGTGAGCTTGTTTGTGTCCCTGNTGG
HKR325650 RBb14C02 pKA1U5 NM_018955.2  
ATTTTAGGGGCGGTTGGCTTTGTTGGGTGACCNNNTTTGTNNCCCTGTGGGTCCACCTGN
HKR326977 RBb17H09 pKA1U5 NM_018955.2  
GAGGGGCGGTTGGCTTTGTTGGGTGAGCTTGTTTGTGTCCCTGTGGGTGGACGTGGTTGG
HKR330879 RBb27D07 pGCAP1 NM_018955.2  
HKR363232 RBd08B08 pGCAP10 NM_018955.2  
GGCATTTAGGGGCGGTTGGCTTTGTTGGGTGAGCTTGTTTGTGTCCCTGTGGGTGGACGT
HKR364176 RBd10H08 pGCAP10 NM_018955.2  
AGTTCCGTCGCAGCCGGGATTTGGGTCGCGGTTCTTGTTTGTGGATCGCTGTGATCGTCA
HKR373274 RBd33D02 pGCAP10 NM_018955.2  
GAGGGGCGGTTGGCTTTGTTGGGTGAGCTTGTTTGTGTCCCTGTGGGTGGACGTGGTTGG
HKR381306 RBd53E10 pGCAP10 NM_018955.2  
GATTGTCGGGCCGGCTGGNTTTGTTGGGNGAGCTTGTTTGTGTCCCTGTGGCTGGACGTG
HKR390035 RBd75B11 pGCAP10 NM_018955.2  
GATTTTAGGGGCGGTTGGCTTTGTTGGGTGAGCTTGTTTGTGTCCCTGTGGGTGGACGTG
HKR390547 RBd76G03 pGCAP10 NM_018955.2  
GGTTGCATAAATTTGCGCTCCGCCAGCCCGGAGCATTTAGGGGCGGTTGGCTTTGTTGGG
HKR396429 RBd91B05 pGCAP10 NM_018955.2  
ATTTTAGGGGCGGTTGGCTTTGTTGGGTGAGCTTGTTTGTGTCCCTGTGGGTGGACGTGG
HKR403010 RBdS007I18 pGCAP10 NM_018955.2  
GATTTTTTAGGGGCGGTTGGCTTTGTTGGGTGAGCTTGTTTGTGTCCCTGTGGGTGGACG
HKR408820 RBdS022A20 pGCAP10 NM_018955.2  
GAGGGGCGGTTGGCTTTGTTGGGTGAGCTTGTTTGTGTCCCTGTGGGTGGACGTGGTTGG
HKR416318 RBdS040N06 pGCAP10 NM_018955.2  
GATTTAGGGGCGGTTGGCTTTGTTGGGTGAGCTTGTTTGTGTCCCTGTGGGTGGACGTGG
HKR428147 RBdS070G03 pGCAP10 NM_018955.2  
GATTTAGGGGCGGTTGGCTTTGTTGGGTGAGCTTGTTTGTGTCCCTGTGGGTGGACGTGG
HKR432686 RBdS081L22 pGCAP10 NM_018955.2  
GGTGTCCCTGTGGGTGGACGTGGTTGGTGATTGGCAGGATCCTGGTATCCGCTAACAGGT
HKR442225 RBdS105J09 pGCAP10 NM_018955.2  
GAGGGGCGGTTGGCTTTGTTGGGTGAGCTTGTTTGTGTCCCTGTGGGTGGACGTGGTTGG
HKR461864 RBdS154K24 pGCAP10 NM_018955.2  
GAGGGGCGGTTGGCTTTGTTGGGTGAGCTTGTTTGTGTCCCTGTGGGTGGACGTGGTTGG
HKR462439 RBdS156B15 pGCAP10 NM_018955.2  
TTTTTTTTTTTTTTTTGAGGGGCGGTTGGCTTTGTTGGGTGAGCTTGTTTGTGTCCCTGT
HKR470986 RBdS177H18 pGCAP10 NM_018955.2  
GGCATTTAGGGGCGGTTGGCTTTGTTGGGTGAGCTTGTTTGTGTCCCTGTGGGTGGACGT
HKR471076 RBdS177L12 pGCAP10 NM_018955.2  
GATTTTAGGGGCGGTTGGCTTTGTTGGGTGAGCTTGTTTGTGTCCCTGTGGGTGGACGTG
HKR475159 RBdS187O23 pGCAP10 NM_018955.2  
GATTTAGGGGCGGTTGGCTTTGTTGGGTGAGCTTGTTTGTGTCCCTGTGGGTGGACGTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl