Prev. |  KEGG KO K00384 > 

RIKEN DNA Bank Human Resource - TXNRD1

Gene ID NCBI Gene 7296 |  KEGG hsa:7296
Gene Symbol TXNRD1
Protein Name thioredoxin reductase 1
Synonyms GRIM-12|TR|TR1|TRXR1|TXNR
Ortholog resource in our bank

  TXNRD1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008814 IRAK022A14 pCMV-SPORT6 BC018122 NM_182743 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR049773 ARe24H05 pKA1U5 NM_003330.2  
GACTCCGGCATTTGCAGCAGAGCGAAAGGTGGCCNATTCCTGAAGGAGGGCCTGATGTCT
HKR056460 ARe41C12 pKA1U5 NM_003330.2  
GATTTTTGCAGCAGAGCGAAAGGTGGTCGAGTCCTGAAGGAGGGCCTGATGTCTTCATCA
HKR065776 ARe64H08 pKA1U5 NM_003330.2  
ATCCTGGGGCTTTTCCAAACCCAGGCAGCTTCGCTGGCGTGTGCGGTTTCGACCCGGTCA
HKR162147 ARi05G03 pGCAP10 NM_003330.2  
GACTCCGGCATTTGCAGCAGAGCGAAAGGTGGTCGAGTCCTGAAGGAGGGCCTGATGTCT
HKR168901 ARi22E05 pGCAP10 NM_003330.2  
GACACAGAGGACGGTCGGGCCCTGGAAGGAACGCTCTCGGAATTGGCCGCGGAAACCGAT
HKR209209 ARiS023A09 pGCAP10 NM_003330.2  
GACACACAGAGGACGGTCGGGCCCTGGAAGGAACGCTCTCGGAATTGGCCGCGGAAACCG
HKR219836 ARiS049J20 pGCAP10 NM_003330.2  
GACACAGAGGACGGTCGGGCCCTGGAAGGAACGCTCTCGGAATTGGCCGCGGAAACCGAT
HKR386578 RBd66H10 pGCAP10 NM_003330.2  
GACACAGAGGACGGTCGGGCCCTGGAAGGAACGCTCTCGGAATTGGCCGCGGAAACCGAT
HKR392884 RBd82D12 pGCAP10 NM_003330.2  
GACTCCGGCATTTGCAGCAGAGCGAAAGGTGGTCGAGTCCTGAAGGAGGGCCTGATGTCT
HKR397703 RBd94E07 pGCAP10 NM_003330.2  
GAGTTTTCTTCACTCCGGCATTTGCAGCAGAGCGAAAGGTGGTGGAGTCCTGAAGGAGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl