Prev. |  KEGG KO K11293 > 

RIKEN DNA Bank Human Resource - HIRA

Gene ID NCBI Gene 7290 |  KEGG hsa:7290
Gene Symbol HIRA
Protein Name histone cell cycle regulator
Synonyms DGCR1|TUP1|TUPLE1
Ortholog resources KEGG ortholog (KEGG orthology K11293) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX033742 IRAK084F22 pCMV-SPORT6 BC039835 NM_003325 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR073256 ARe83C08 pKA1U5 NM_003325.3 done
GGGCGCAGGGGATGCGGCTGTGGTGGCGGCGGCNGCGGCCGANCGCGGGTGGCGGCTGTG
HKR362025 RBd05B01 pGCAP10 NM_003325.3 done
GGTTGCCCGGGAGCCGCCTGAGGAGGAGCGGCGCAGGGGATGCGGCTGTGGTGGCGGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl