Prev. |  KEGG KO K09527 > 

RIKEN DNA Bank Human Resource - DNAJC7

Gene ID NCBI Gene 7266 |  KEGG hsa:7266
Gene Symbol DNAJC7
Protein Name DnaJ heat shock protein family (Hsp40) member C7
Synonyms DJ11|DJC7|TPR2|TTC2
Ortholog resource in our bank

  DNAJC7

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027289 IRAK068D17 pCMV-SPORT6 BC033772 NM_003315 Full
HGY083262 IRAL008C14 pOTB7 BC003601 NM_003315 Partial
HGY091361 IRAL028G17 pOTB7 BC011837 NM_003315 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE099246 M01C048B22 pDONR221 MGC13-H11 BC011837 NM_003315  
HGE099294 M01C048D22 pDONR221 MGC13-H11 BC011837 NM_003315  
HGE099342 M01C048F22 pDONR221 MGC13-H11 BC011837 NM_003315  
HGE099390 M01C048H22 pDONR221 MGC13-H11 BC011837 NM_003315  
HGE099438 M01C048J22 pDONR221 MGC13-H11 BC011837 NM_003315  
HGE099486 M01C048L22 pDONR221 MGC13-H11 BC011837 NM_003315  
HGE099534 M01C048N22 pDONR221 MGC13-H11 BC011837 NM_003315  
HGE099582 M01C048P22 pDONR221 MGC13-H11 BC011837 NM_003315  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR326428 RBb16B04 pKA1U5 NM_003315.1  
GGCGGTAAGATGGCGGCTGCCGCGGAGTGCGATGTGGTAATGGCGGCGACCGAGCCGGAG
HKR331683 RBb29D11 pGCAP1 NM_003315.1  
AAATGTGACCGCCGGCCTCCCACCCAGCTCTCTGGTCCCGGCGGTAAGATGGCGGCTGCC
HKR452989 RBdS132H21 pGCAP10 NM_003315.1  
GGCTCTTCACCGCCGGCCTCCCACCCAGCTCTCTGGTCCCGGCGGTAAGATGGCGGCTGC
HKR474870 RBdS187C22 pGCAP10 NM_003315.1  
GCTCTCCCGCTTCCGCCTGGCGTANGAGCTGAGGCATGGCCTTGTTCTCCAGCTGANAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl