RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - TSC2

Gene ID	NCBI Gene 7249 \| KEGG hsa:7249
Gene Symbol	TSC2
Protein Name	TSC complex subunit 2
Synonyms	LAM\|PPP1R160\|TSC4

Ortholog resource in our bank

  TSC2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	CDS comparison
Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	Refered (NCBI mRNA)	CDS status⁽²⁾
HGY085803	IRAL014I11	pOTB7	BC025364	NM_021056	Partial/var
HGY097628	IRAL044B04	pOTB7	BC046929	NM_021056	Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR416210	RBdS040I18	pGCAP10	NM_000548.5
HKR416210	GAGGGGGGTGCGCCTTTCTCCGCGTCGGGGCGGCCCGGAGCGCGGTGGCGCGGCGCGGGA
HKR406144	RBdS015F24	pGCAP10	NM_001363528.2
HKR406144	GGTCGCGCTTCCGGCGGCGTCCCGGGGCCAGGGGGGTGCGCCTTTCTCCGCGTCGGGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl