Prev. | 

RIKEN DNA Bank Human Resource - TSN

Gene ID NCBI Gene 7247 |  KEGG hsa:7247
Gene Symbol TSN
Protein Name translin
Synonyms BCLF-1|C3PO|RCHF1|REHF-1|TBRBP|TRSLN
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04471 SEREX clone BRC-Co-60 #1 SEREX clone BRC-Co-60 #1

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080606 IRAL001I14 pOTB7 BC002359 NM_004622 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE049663 W01A124C15 pENTR-TOPO IRAL001I14 BC002359 NM_004622  
HGE049667 W01A124C19 pENTR-TOPO IRAL001I14 BC002359 NM_004622  
HGE049669 W01A124C21 pENTR-TOPO IRAL001I14 BC002359 NM_004622  
HGE049671 W01A124C23 pENTR-TOPO IRAL001I14 BC002359 NM_004622  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR052099 ARe30E03 pKA1U5 NM_004622.2  
GGCGGCGGTAGCGGCGGCCGTTGCGATTGATTGCGCTGGTTGCCTGCGGCGTCCACTTCC
HKR080478 ARf01D06 pKA1U5 NM_004622.2  
GGCTGGTTGCCTGCGGCGTCCACTTCCTTGGCCGCCCTTGCTACACTGGCTGATTGTTGT
HKR205332 ARiS013F12 pGCAP10 NM_004622.2  
GAGCGGCGGCCGTTGCGATTGATTGCGCTGGTTGCCTGCGGCGTCCACTTCCTTGGCCGC
HKR209365 ARiS023G21 pGCAP10 NM_004622.2  
GGCGTAAGACCGGGGGGACGCGGCGGTAGCGGCGGCCGTTGCGATTGATTGCGCTGGTTG
HKR332049 RBb30C01 pGCAP1 NM_004622.2  
GTGGGTTGTGCAGCCGGCGCCATGTCTGTGAGCGAGATCTTCGTGGAGCTGCAGGGCTTT
HKR362835 RBd07B11 pGCAP10 NM_004622.2  
GAGGAAGCGCTACGACGGATTGAAATATGACGTGAAGAAAGTAGAGGAAGTGGTCTATGA
HKR428157 RBdS070G13 pGCAP10 NM_004622.2  
GAGCGNNNNCCGTTGCGATTGATTGCGCTGGTTGCCTGCGGCGTCCACTTCCTTGGCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl