Prev. |  KEGG KO K12792 > 

RIKEN DNA Bank Human Resource - TRIP6

Gene ID NCBI Gene 7205 |  KEGG hsa:7205
Gene Symbol TRIP6
Protein Name thyroid hormone receptor interactor 6
Synonyms OIP-1|OIP1|TRIP-6|TRIP6i2|ZRP-1
Ortholog resource in our bank

  TRIP6

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX017131 IRAK042N19 pCMV-SPORT6 BC028985 NM_003302 Full
HGY083876 IRAL009L12 pOTB7 BC004999 NM_003302 Full
HGY085061 IRAL012K21 pOTB7 BC002680 NM_003302 Full/var
HGY085485 IRAL013L21 pOTB7 BC021540 NM_003302 Full/var
HGY085533 IRAL013N21 pOTB7 BC004249 NM_003302 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE007445 W01A018K05 pENTR-TOPO IRAL012K21 BC002680 NM_003302  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR082476 ARf06D04 pKA1U5 NM_003302.2  
GCTTTTCTGGAGTCCCAAACGAGGTGCGGGACGGAAGAGGGGGTGAAGGCCAGAGGCTCG
HKR168953 ARi22G09 pGCAP10 NM_003302.2  
GCAGAAAAAGTTTTCTTTTCTGGAGTCCCAAACGAGGTGCGGGACGGAAGAGGGGGTGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl