Prev. |  KEGG KO K09495 > 

RIKEN DNA Bank Human Resource - CCT3

Gene ID NCBI Gene 7203 |  KEGG hsa:7203
Gene Symbol CCT3
Protein Name chaperonin containing TCP1 subunit 3
Synonyms CCT-gamma|CCTG|PIG48|TCP-1-gamma|TRIC5
Ortholog resources KEGG ortholog (KEGG orthology K09495) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080859 IRAL002C11 pOTB7 BC006501 NM_005998 Full
HGY089415 IRAL023I23 pOTB7 BC008019 NM_005998 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR047731 ARe19F11 pKA1U5 NM_005998.3  
GCTCTCCAGAAGGTTCTGCCGGTTCCCCCAGCTCTGGGTACCCGGCTCTGCATCGCGTCG
HKR052853 ARe32C05 pKA1U5 NM_005998.3  
GGGGTTGAGGTGTAAGCCCTGAGGAGGCAGCGTTTTCTGGGCTTCTGTCTGGTTCTCTCT
HKR058408 ARe46A08 pKA1U5 NM_005998.3  
GGTAAGCCCTGAGGAGGCAGCGTTTTCTGGGCTTCTGTCTGGTTCTCTCTCCAGAAGGTT
HKR171259 ARi28C11 pGCAP10 NM_005998.3  
GCCAGAAGGTTCTGCCGGTTCCCCCAGCTCTGGGTACCCGGCTCTGCATCGCGTCGCCAT
HKR203484 ARiS008L20 pGCAP10 NM_005998.3  
CGGCCGGCCGATGTGTAAGCCCTGAGGAGGCAGCGTTTTCTGGGCTTCTGTCTGGTTCTC
HKR219849 ARiS049K09 pGCAP10 NM_005998.3  
GGGAGGCAGCGTTTTCTGGGCTTCTGTCTGGTTCTCTCTCTCCAGAAGGTTCTGCCGGTT
HKR234836 ARiS087B12 pGCAP10 NM_005998.3  
GAAGCCCTGAGGAGGCAGCGTTTTCTGGGCTTCTGTCTGGTTCTCTCTCTCCAGAAGGTT
HKR320932 RBb02F12 pKA1U5 NM_005998.3  
GCTCTCTCTCCAGAAGGTTCTGCCGGTTCCCCCAGCTCTGGGTACCCGGCTCTGCATCGC
HKR329230 RBb23B06 pGCAP1 NM_005998.3  
ATGGGGGAGGCAGCGTTTTCTGGGCTTCTGTCTGGTTCTCTCTCCAGAAGGTTCTGCCGG
HKR333632 RBb34B08 pGCAP1 NM_005998.3  
GGGAGGCAGCGTTTTCTGGGCTTCTGTCTGGTTCTCTCTCCAGAAGGTTCTGCCGGTTCC
HKR334931 RBb37F11 pGCAP1 NM_005998.3  
GGGAGGCAGCGTTTTCTGGGCTTCTGTCTGGTTCTCTCTCCAGAAGGTTCTGCCGGTTCC
HKR339371 RBb48H03 pGCAP1 NM_005998.3  
GCCAGAAGGTTCTGCCGGTTCCCCCAGCCTCTGGGTACCCGGCTCTGCATCGCGTCGCCA
HKR365745 RBd14G01 pGCAP10 NM_005998.3  
GAGGAGGCAGCGTTTTCTGGGCTTCTGTCTGGTTCTCTCTCCAGANGTTCTGCCGGTTCC
HKR369747 RBd24G03 pGCAP10 NM_005998.3  
GTCTCTCTCCAGAAGGTTCTGCCGGTTCCCCCAGCTCTGGGTACCCGGCTCTGCATCGCG
HKR374426 RBd36B02 pGCAP10 NM_005998.3  
GGTAAGCCCTGAGGAGGCAGCGTTTTCTGGGCTTCTGTCTGGTTCTCTCTCCAGAAGGTT
HKR381281 RBd53D09 pGCAP10 NM_005998.3  
GGCTTCTGTCTGGTTCTCTCTCTCCAGAAGGTTCTGCCGGTTCCCCNAGCTCTGGGTACC
HKR389653 RBd74C05 pGCAP10 NM_005998.3  
TGGGGCTTCTGTCTGGTTCTCTCTCCAGAAGGTTCTGCCGGTTCCCCCAGCTCTGGGTAC
HKR409135 RBdS022N23 pGCAP10 NM_005998.3  
GCCAGAAGGTTCTGCCGGTTCCCCCAGCTCTGGGTACCCGGCTCTGCATCGCGTCGCCAT
HKR420678 RBdS051L14 pGCAP10 NM_005998.3  
ACCCAGGATGAAGAGGTTGGAGATGGGACCACATCAGTAATTATTCTTGCAGGGGAAATG
HKR428268 RBdS070L04 pGCAP10 NM_005998.3  
TTGGTCTGGTTCTCTCTCTCCNNANNGTTCTGCCGGTTCCCCCAGCTCTGGGTACCCGGC
HKR432721 RBdS081N09 pGCAP10 NM_005998.3  
GGTCTGGTTCTCTCTCTCCAGAAGGTTCTGCCGGTTCCCCCAGCTCTGGGTACCCGGCTC
HKR475179 RBdS187P19 pGCAP10 NM_005998.3  
GAGCGGGTTGAGGTGTAAGCCCTGAGGAGGCAGCGTTTTCTGGGCTTCTGTCTGGTTCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl