Prev. |  KEGG KO K09487 > 

RIKEN DNA Bank Human Resource - HSP90B1

Gene ID NCBI Gene 7184 |  KEGG hsa:7184
Gene Symbol HSP90B1
Protein Name heat shock protein 90 beta family member 1
Synonyms ECGP|GP96|GRP94|HEL-S-125m|HEL35|TRA1
Ortholog resources KEGG ortholog (KEGG orthology K09487) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX056320 IRAK140N08 pCMV-SPORT6 BC066656 NM_003299 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE034720 W01A086N08 pENTR-TOPO IRAK140N08 BC066656 NM_003299  
HGE034724 W01A086N12 pENTR-TOPO IRAK140N08 BC066656 NM_003299  
HGE034730 W01A086N18 pENTR-TOPO IRAK140N08 BC066656 NM_003299  
HGE034734 W01A086N22 pENTR-TOPO IRAK140N08 BC066656 NM_003299  

♦ W series clone contains a stop codon.

GNP_entry_W01A_210404.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040500 ARe01E04 pKA1U5 NM_003299.1  
GGTAGTGGGCGGACCGCGCGGCTGGAGGTGTGAGGACCCGAACCCAGGGGTGGAGGCGGC
HKR043726 ARe09F06 pKA1U5 NM_003299.1  
GGTGGGCGGACCGCGCGGCTGGAGGTGTGAGGATCCGAACCCAGGGGTGGGGGGTGGAGG
HKR052433 ARe31B09 pKA1U5 NM_003299.1  
GAGTGGGCGGACCGCGCGGCTGGAGGTGTGAGGATCCGAACCCAGGGGTTGGGGGGTGGA
HKR055703 ARe39E07 pKA1U5 NM_003299.1  
GAGTGGGCGGACCGCGCGGCTGGAGGTGTGAGGATCCGAACCCAGGGGTGGGGGGTGGAG
HKR060499 ARe51E03 pKA1U5 NM_003299.1  
GGTAGTGGGCGGACCGCGCGGCTGGAGGTGTGAGGATCCGAACCCAGGGGTGGAGGCGGC
HKR070130 ARe75F10 pKA1U5 NM_003299.1  
GAGTGGGCGGACCGCGCGGCTGGAGGTGTGAGNATCCGAACCCAGGGGTGGGGGGTGGAG
HKR079206 ARe98A06 pKA1U5 NM_003299.1  
GGTGGGCGGACCGCGCGGCTGGAGGTGTGAGGATCCGAACCCAGGGGTGGGGGGTGGAGG
HKR166151 ARi15G07 pGCAP10 NM_003299.1  
TCTTAATGTTTCCCGTCCCCCGCCCGCGAGAAGTGGGGGTGAAAAGCGGCCCGACCTGCT
HKR167352 ARi18G08 pGCAP10 NM_003299.1  
GGGGCGGACCGCGCGGCTGGAGGTGTGAGGATCCGAACCCAGGGGTGGAGGCGGCTCCTG
HKR168577 ARi21H09 pGCAP10 NM_003299.1  
GAGTGGGCGGACCGCGCGGCTGGAGGTGTGAGGATCCGAACCCTNGGGTGGGGGGTGGAG
HKR174124 ARi35F04 pGCAP10 NM_003299.1  
GAGTGGGCGGACCGCGCGGCTGGAGGTGTGAGGATCCGAACCCAGGGGTGGGGGGTGGAG
HKR180554 ARi51G10 pGCAP10 NM_003299.1  
GAGTGGGCGGACCGCGCGGCTGGAGGTGTGAGGATCCGAACCCAGGGGTGGAGGCGGCTC
HKR183276 ARi58D04 pGCAP10 NM_003299.1  
GGTGGGCGGACCGCGCGGCTGGAGGTGTGAGGATCCNACCCAGGNTGGGGNNGAGGCGNT
HKR186931 ARi67F11 pGCAP10 NM_003299.1  
AAGGGGCGGACCGCGCGGCTGGAGGTGTGAGGATCCGAACCCAGGGGTGGGGGGTGGAGG
HKR203584 ARiS008P24 pGCAP10 NM_003299.1  
GGTAGTGGGCGGACCGCGCGGCTGGAGGTGTGAGGATCCGAACCCAGGGGTGGAGGCGGC
HKR209519 ARiS023N07 pGCAP10 NM_003299.1  
GGTAGTGGGCGGACCGCGCGGCTGGAGGTGTGAGGATCCGAACCCAGGGGTGGGGGGTGG
HKR222105 ARiS055E09 pGCAP10 NM_003299.1  
GAGTGGGCGGACCGCGCGGCTGGAGGTGTGAGGATCCGAACCCAGGGGTGGAGGCGGCTC
HKR238633 ARiS096J17 pGCAP10 NM_003299.1  
GCCCCCCGCCCGCGAGAAGTGGGGGTGAAAAGCGGCCCGACCTGCTTGCGGTGTAGTGGG
HKR243899 ARiS109M11 pGCAP10 NM_003299.1  
CGGCCNNNNNNTGAGTGGGCGGACCGCGCGGCTGGAGGTGTGAGGATCCGAACCCAGGGG
HKR248819 ARiS122A19 pGCAP10 NM_003299.1  
HKR248997 ARiS122I05 pGCAP10 NM_003299.1  
GGTAGTGNGCGGACCNCGCGGCTGGANGTGTGAGGATCCGAACCCAGGGGTGGGGGGTGG
HKR279453 ARiS198K13 pGCAP10 NM_003299.1  
GGTNGTGGGCGGACCGCGCGGCTGGAGGTGTGAGGATCCGAACCCAGGGGTGGAGGCGGC
HKR405625 RBdS014B01 pGCAP10 NM_003299.1  
GAGTGGGCGGACCGCGCGGCTGGAGGTGTGAGGATCCGAACCCAGGGGTGGGGGGTGGAG
HKR405698 RBdS014E02 pGCAP10 NM_003299.1  
GGTAGTGGGCGGACCGCGCGGCTGGAGGTGTGAGGATCCGAACCCAGGGGTGGGGGGTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_210404.csv
NRCDhumcloneList_RB_210404.csv


2021.04.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_210329.pl