Prev. |  KEGG KO K08543 > 

RIKEN DNA Bank Human Resource - NR2C1

Gene ID NCBI Gene 7181 |  KEGG hsa:7181
Gene Symbol NR2C1
Protein Name nuclear receptor subfamily 2 group C member 1
Synonyms TR2
Ortholog resource in our bank

  NR2C1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX033690 IRAK084D18 pCMV-SPORT6 BC040141 NM_003297
HGY013650 IRAK034C02 pBluescriptR BC026074 NM_003297 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE036863 W01A092C15 pENTR-TOPO IRAK084D18 BC040141 NM_003297  
HGE036867 W01A092C19 pENTR-TOPO IRAK084D18 BC040141 NM_003297  
HGE036869 W01A092C21 pENTR-TOPO IRAK084D18 BC040141 NM_003297  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR073227 ARe83B03 pKA1U5 NM_003297.2  
GAGAAATACCCANACACAGCAAAGCTCTCTCCGCCGCTGTNATCTCGATCCCACATCCCG
HKR392854 RBd82C06 pGCAP10 NM_003297.2  
GGGGATAGCGCGCCGCCGAGCCGAGAAAGAGGTCACGAACTCTGACCCCCCAGAAATACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl