Prev. | 

RIKEN DNA Bank Human Resource - TPT1

Gene ID NCBI Gene 7178 |  KEGG hsa:7178
Gene Symbol TPT1
Protein Name tumor protein, translationally-controlled 1
Synonyms HRF|TCTP|p02|p23
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001441 IRAK003K01 pCMV-SPORT6 BC003352 NM_003295 Full
HGX008709 IRAK021M21 pCMV-SPORT6 BC012431 NM_003295 Full/var
HGX046223 IRAK115J07 pCMV-SPORT6 BC052333 NM_003295 Full
HGY094274 IRAL035L10 pDNR-LIB BC022436 NM_003295 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR041375 ARe03H07 pKA1U5 NM_003295.2  
CTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGCTCCG
HKR046526 ARe16F06 pKA1U5 NM_003295.2  
GCTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCNTCCGGCTGCACCGCGCTCGCTC
HKR047750 ARe19G06 pKA1U5 NM_003295.2  
ATCCTGTGGCTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCG
HKR048855 ARe22C07 pKA1U5 NM_003295.2  
ATCCTGGCTTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGC
HKR049777 ARe24H09 pKA1U5 NM_003295.2  
GCTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGNTCCGGCTGCACCGCGCTCGCTCC
HKR050810 ARe27A10 pKA1U5 NM_003295.2  
ATCCTGCTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTC
HKR050881 ARe27D09 pKA1U5 NM_003295.2  
TGCTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGCTC
HKR052178 ARe30H10 pKA1U5 NM_003295.2  
GCTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGCTCC
HKR058928 ARe47F08 pKA1U5 NM_003295.2  
GGTGCTAAGCTAGCGCCGTCGTCGTCTCCCTTCAGTTCGCCATCATGATTATCTACCGGG
HKR062169 ARe55H01 pKA1U5 NM_003295.2  
ATCCTGGCTTTTCCGCCCGCTCCCCCCTCCCCCCNATTGCCGCTCCGGCTGCACCGCGCT
HKR068505 ARe71E09 pKA1U5 NM_003295.2  
GCTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGCTCC
HKR074131 ARe85F11 pKA1U5 NM_003295.2  
ATCCTGCTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTC
HKR075250 ARe88C02 pKA1U5 NM_003295.2  
ATCCTGCTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTC
HKR076504 ARe91E08 pKA1U5 NM_003295.2  
CTTTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGCTC
HKR079708 ARe99E12 pKA1U5 NM_003295.2  
GCTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGCTCC
HKR161651 ARi04C03 pGCAP10 NM_003295.2  
CGGCCGGCCGATGCTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCAC
HKR162969 ARi07H01 pGCAP10 NM_003295.2  
GCTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGCTCC
HKR163233 ARi08B09 pGCAP10 NM_003295.2  
CTTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGCTCC
HKR164802 ARi12A02 pGCAP10 NM_003295.2  
GCTTTTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGC
HKR167300 ARi18E04 pGCAP10 NM_003295.2  
TTGCTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGCT
HKR172526 ARi31F06 pGCAP10 NM_003295.2  
GCTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGCTCC
HKR175771 ARi39H03 pGCAP10 NM_003295.2  
GGCCAGAAGTCCTGCCAGACTCGGCAAGAAAACAGAGAAACGAAAGGAAGCGGGAAGGAC
HKR177602 ARi44A02 pGCAP10 NM_003295.2  
GCTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGCTCC
HKR178073 ARi45D01 pGCAP10 NM_003295.2  
GCTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGCTCC
HKR178124 ARi45F04 pGCAP10 NM_003295.2  
GTGGAGGGATGACGTAGAGGGACGTGCCCTCTATATGAGGTTGGGGAGCGGCTGAGTCGG
HKR181229 ARi53B05 pGCAP10 NM_003295.2  
GCTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGCTCC
HKR182570 ARi56H02 pGCAP10 NM_003295.2  
GCTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGCTCC
HKR185257 ARi63C09 pGCAP10 NM_003295.2  
GCTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGCTCCG
HKR186877 ARi67D05 pGCAP10 NM_003295.2  
GCTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGCTCC
HKR188006 ARi70A06 pGCAP10 NM_003295.2  
CTTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGCTCC
HKR205523 ARiS013N11 pGCAP10 NM_003295.2  
GCTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGCTCC
HKR218341 ARiS045O05 pGCAP10 NM_003295.2  
GGGCCTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGC
HKR235087 ARiS087L23 pGCAP10 NM_003295.2  
GGCCNTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGCT
HKR260099 ARiS150E03 pGCAP10 NM_003295.2  
AGCTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGCTC
HKR276461 ARiS191C13 pGCAP10 NM_003295.2  
GCTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGCTCC
HKR276782 ARiS191P22 pGCAP10 NM_003295.2  
GCTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGCTCC
HKR277676 ARiS194D04 pGCAP10 NM_003295.2  
CTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGCTCCG
HKR279292 ARiS198D20 pGCAP10 NM_003295.2  
GCTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGCTCC
HKR323202 RBb08A02 pKA1U5 NM_003295.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR326521 RBb16F01 pKA1U5 NM_003295.2  
GCTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGCTCC
HKR332880 RBb32D08 pGCAP1 NM_003295.2  
AATGTGGCCTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGC
HKR340030 RBb50B06 pGCAP1 NM_003295.2  
GCTTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGCTC
HKR345374 RBb63H06 pGCAP1 NM_003295.2  
GAGCGGGCGATGACGTAGAGGGACGTGCCCTCTATATGAGGTTGGGGAGCGGCTGAGTCG
HKR346897 RBb67E01 pGCAP1 NM_003295.2  
TTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGCTCCG
HKR362874 RBd07D02 pGCAP10 NM_003295.2  
GCTTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGCTC
HKR363225 RBd08B01 pGCAP10 NM_003295.2  
GCTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGCTCC
HKR373371 RBd33H03 pGCAP10 NM_003295.2  
GGTGCGTCTGGCGTCCGCGCGCTGCACAATGGCGGCTCTGAAGAGTTGGCTGTCGCGCAG
HKR376833 RBd42B09 pGCAP10 NM_003295.2  
GGGCCTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGC
HKR379352 RBd48G08 pGCAP10 NM_003295.2  
GATATGAGGTTGGGGAGCGGCTGACTCNATCTTTTCCGCCCGCACCCCTCTCCCTNAAAG
HKR381308 RBd53E12 pGCAP10 NM_003295.2  
GCTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGCTCC
HKR385681 RBd64D09 pGCAP10 NM_003295.2  
GCTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGCTCC
HKR386900 RBd67E04 pGCAP10 NM_003295.2  
GCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGCTCCGAGTTTCAGGCTCGTGCTAAGCT
HKR388969 RBd72H01 pGCAP10 NM_003295.2  
GCTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGCTCC
HKR397707 RBd94E11 pGCAP10 NM_003295.2  
GCTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGCTCC
HKR402933 RBdS007F13 pGCAP10 NM_003295.2  
GGAGCGCCGCTCCGGCTGCACCGCGCTCGCTCCGAGTTTCAGGCTCGTGCTAAGCTAGCG
HKR405552 RBdS013O16 pGCAP10 NM_003295.2  
GCTTTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGCT
HKR406269 RBdS015L05 pGCAP10 NM_003295.2  
CGGCCGGCCGATGCTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCAC
HKR416349 RBdS040O13 pGCAP10 NM_003295.2  
GCTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGCTCC
HKR430310 RBdS075M22 pGCAP10 NM_003295.2  
GCTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGCTCC
HKR452851 RBdS132C03 pGCAP10 NM_003295.2  
GCTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGCTCC
HKR461945 RBdS154O09 pGCAP10 NM_003295.2  
GCTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCNGCTGCACCGCGCTCGCTCC
HKR462454 RBdS156C06 pGCAP10 NM_003295.2  
TGCTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGCTC
HKR471089 RBdS177M01 pGCAP10 NM_003295.2  
GGGCCTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGC
HKR474846 RBdS187B22 pGCAP10 NM_003295.2  
GCTTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl