Prev. |  KEGG KO K10374 > 

RIKEN DNA Bank Human Resource - TPM2

Gene ID NCBI Gene 7169 |  KEGG hsa:7169
Gene Symbol TPM2
Protein Name tropomyosin 2
Synonyms AMCD1|DA1|DA2B|DA2B4|HEL-S-273|NEM4|TMSB
Ortholog resource in our bank

  TPM2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03817 SEREX clone NGO-St-052 (ID 282) #1 SEREX clone NGO-St-052 (ID 282) #1; TPM2 tropomyosin 2 (beta)
RDB03838 SEREX clone NGO-St-052 (ID 282) #2 SEREX clone NGO-St-052 (ID 282) #2
RDB04428 SEREX clone BRC-Co-11 #1 SEREX clone BRC-Co-11 #1
RDB06708 pET_hsTPM2 Prokaryotic expression vector of human Tropomyosin 2 (beta)
RDB06709 pET_hsPM2 Prokaryotic expression vector of human TPM2 tropomyosin 2 (beta)

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY090988 IRAL027H20 pOTB7 BC011776 NM_213674 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE099232 M01C048B08 pDONR221 MGC13-H04 BC011776 NM_213674  
HGE099280 M01C048D08 pDONR221 MGC13-H04 BC011776 NM_213674  
HGE099328 M01C048F08 pDONR221 MGC13-H04 BC011776 NM_213674  
HGE099376 M01C048H08 pDONR221 MGC13-H04 BC011776 NM_213674  
HGE099424 M01C048J08 pDONR221 MGC13-H04 BC011776 NM_213674  
HGE099472 M01C048L08 pDONR221 MGC13-H04 BC011776 NM_213674  
HGE099520 M01C048N08 pDONR221 MGC13-H04 BC011776 NM_213674  
HGE099568 M01C048P08 pDONR221 MGC13-H04 BC011776 NM_213674  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR043611 ARe09A11 pKA1U5 NM_003289.3  
GAGTCCCGCTCCGNTCCTCCTCGCCTGCCACCGGATGCACCCAGNTCCGCTCACCCAGCC
HKR050431 ARe26B07 pKA1U5 NM_003289.3  
GAGTCCCGCTCCGTCCTCCTCGCCTGCCACCGGATGCACCCAGNTCCGCTCACCCAGCCC
HKR054555 ARe36G11 pKA1U5 NM_003289.3  
GCCAGTCCCGCTCCGTCCTCCTCGCCTGCCACCGGTTTCACCCAGTCCGCTCACCCAGCC
HKR058974 ARe47H06 pKA1U5 NM_003289.3  
GAGTCCCGCTCCGTCCTCCTCGCCTGCCACCGGCTGNTNCCAGNTCCGCTCACCCAGCCC
HKR060873 ARe52D01 pKA1U5 NM_003289.3  
GAGTCCCGCTCCGNTCCTCCTCGCCTGCCACCGGCTGTNANCCAGNTCCGCTCACCCAGC
HKR069297 ARe73E01 pKA1U5 NM_003289.3  
GAGTCCCGCTCCGTCCTCCTCGCCTGCCACCGGCTGCNNCCAGTCCGCTCACCCAGCCCA
HKR071604 ARe79A04 pKA1U5 NM_003289.3  
GCCCAGTCCCGCTCCGTCCTCCTCGCCTGCCACCGGNTGCACCCAGNTCCGCTCACCCAG
HKR073297 ARe83E01 pKA1U5 NM_003289.3  
GCCCAGTCCCGCTCCGTCCTCCTCGCCTGCCACCGGATGCACCCAGTCCGCTCACCCAGC
HKR076575 ARe91H07 pKA1U5 NM_003289.3  
GAGTCCCGCTCCGTCCTCCTCGCCTGCCACCGGTGCACCCAGTCCGCTCACCCAGCCCAG
HKR082832 ARf07B08 pKA1U5 NM_003289.3  
GAGTCCCGCTCCGTCCTCCTCGCCTGCCACCGGTGCACCCAGTCCGCTCACCCAGCCCAG
HKR164410 ARi11A10 pGCAP10 NM_003289.3  
GAGTCCCGCTCCGTCCTCCTCGCCTGCCACCGGTGCACCCAGTCCGCTCACCCAGCCCAG
HKR172502 ARi31E06 pGCAP10 NM_003289.3  
GAGTCCCGCTCCGTCCTCCTCGCCTGCCACCGGTGCACCCAGTCCGCTCACCCAGCCCAG
HKR179305 ARi48E09 pGCAP10 NM_003289.3  
GAGTCCCGCTCCGTCCTCCTCGCCTGCCACCGGTGCACCCAGTCCGCTCACCCAGCCCAG
HKR218186 ARiS045H18 pGCAP10 NM_003289.3  
HKR234232 ARiS085J16 pGCAP10 NM_003289.3  
GAGTCCCGCTCCGTCCTCCTCGCCTGCCACCGGTGCACCCAGTCCGCTCACCCAGCCCAG
HKR238425 ARiS096B01 pGCAP10 NM_003289.3  
TGCCCAGTCCCGCTCCGTCCTCCTCGCCTGCCACCGGTGCACCCAGTCCGCTCACCCAGC
HKR247291 ARiS118D19 pGCAP10 NM_003289.3  
GAGTCCCGCTCCGTCCTCCTCGCCTGCCACCGGTGCACCCAGTCCGCTCACCCAGCCCAG
HKR247501 ARiS118M13 pGCAP10 NM_003289.3  
GAGTCCCNCTCCGTCCTCCTCGCCTGCCACCGGTGCACCCAGTCCGCTCACCCAGCCCAG
HKR264780 ARiS161P20 pGCAP10 NM_003289.3  
GAGTCCCGCTCCGTCCTCCTCGCCTGCCACCGGTGCACCCAGTCCGCTCACCCAGCCCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl