Prev. | 

RIKEN DNA Bank Human Resource - TPD52L2

Gene ID NCBI Gene 7165 |  KEGG hsa:7165
Gene Symbol TPD52L2
Protein Name TPD52 like 2
Synonyms D54|TPD54
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001304 IRAK003E08 pCMV-SPORT6 BC006804 NM_003288 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR175721 ARi39F01 pGCAP10 NM_003288.2  
AGTTCCGCTGGCTAGTGTGTACGCGGCGAGCTTCTCCCGGCGCCGCCCGCTCGGCTCCCA
HKR175746 ARi39G02 pGCAP10 NM_003288.2  
AGTTCCGCTGGCTAGTGTGTACGCGGCGAGCTTCTCCCGGCGCCGCCCGCTCGGCTCCCA
HKR234926 ARiS087F06 pGCAP10 NM_003288.2  
GATAGCGCCCGCGACAGCGGTCCGGACGCCGCCCGAACATGGACTCCGCCGGCCAAGATA
HKR260262 ARiS150K22 pGCAP10 NM_003288.2  
GATATAGCGCCCGCGACAGCGGTCCGGACGCCGCCCGAACATGGACTCCGCCGGCCAAGA
HKR277665 ARiS194C17 pGCAP10 NM_003288.2  
GAGTTNNTTTNGCTANTGTGTACNCGGCGAGCTTCTCCCGGCGCCGCCCGCTCGGCTCCC
HKR366929 RBd17F09 pGCAP10 NM_003288.2  
GGCGGAGCTGAGGCAGTTCCGCTGGCTAGTGTGTACGCGGCGAGCTTCTCCCGGCGCCGC
HKR441737 RBdS104F17 pGCAP10 NM_003288.2  
GCCGCTGGCTAGTGTGTACGCGGCGAGCTTCTCCCGGCGCCGCCCGCTCGGCTCCCATAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl