Prev. |  KEGG KO K10148 > 

RIKEN DNA Bank Human Resource - TP73

Gene ID NCBI Gene 7161 |  KEGG hsa:7161
Gene Symbol TP73
Protein Name tumor protein p73
Synonyms CILD47|P73
Featured content Hippo signaling (human)
Ortholog resource in our bank

  TP73

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB02962 pcDNA3-p73alpha Expression vector for human p73 alpha, based on pcDNA3
RDB02963 pcDNA3-p73beta Expression vector for human p73beta, based on pcDNA3
RDB02964 pcDNA3-p73gamma Expression vector for human p73gamma, based on pcDNA3
RDB02965 pcDNA3-p73epsilon Expression vector for human p73epsilon, based on pcDNA3
RDB05529 pKM2L-phTP73 Promoter Bank clone, Human p73 tumor protein (TP73) promoter
RDB07381 pGL4-phTP73 Promoter collection, Human TP73 promoter

webcatalog20220516.tab


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR389635 RBd74B11 pGCAP10 NM_005427.1  
GAGCCAGTTGACAGAACTAAGGGAGATGGGAAAAGCGAAAATGCCAACAAACGGCCCGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.08.18

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl