Prev. |  KEGG KO K03158 > 

RIKEN DNA Bank Human Resource - TNFRSF1A

Gene ID NCBI Gene 7132 |  KEGG hsa:7132
Gene Symbol TNFRSF1A
Protein Name TNF receptor superfamily member 1A
Synonyms CD120a|FPF|TBP1|TNF-R|TNF-R-I|TNF-R55|TNFAR|TNFR1|TNFR55|TNFR60|p55|p55-R|p60
Ortholog resources KEGG ortholog (KEGG orthology K03158) in the DNA Bank
Featured content Sphingolipid signaling pathway (human)
Featured content NF-kappa B signaling pathway (human)
Featured content Apoptosis - human
Featured content Alzheimer disease - human
Featured content Amyotrophic lateral sclerosis (ALS) - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY091110 IRAL027M22 pOTB7 BC010140 NM_001065 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE015351 W01A038G07 pENTR-TOPO IRAL027M22 BC010140 NM_001065  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR054528 ARe36F08 pKA1U5 NM_001065.2  
GGCAACACTGCCTCACTCTTCCCCTCCCACCTTCTCTCCCCTCCTCTCTGCTTTAATTTT
HKR060553 ARe51G09 pKA1U5 NM_001065.2  
GAGTTCTGGCCTTTGGGGTTCAAGATCACTGGGACCAGGCCGTGATCTCTATGCCCGAGT
HKR067204 ARe68A04 pKA1U5 NM_001065.2  
GGCTTTAATTTTCTCAGAATTCTCTGGACTGAGGCTCCAGNTTCTGGCCTTTGGGGTTCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl