Prev. |  KEGG KO K15074 > 

RIKEN DNA Bank Human Resource - TNFAIP1

Gene ID NCBI Gene 7126 |  KEGG hsa:7126
Gene Symbol TNFAIP1
Protein Name TNF alpha induced protein 1
Synonyms B12|B61|BTBD34|EDP1|hBACURD2
Ortholog resource in our bank

  TNFAIP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081171 IRAL002P11 pOTB7 BC001643 NM_021137 Full
HGY083940 IRAL009O04 pOTB7 BC001949 NM_021137 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR050929 ARe27F09 pKA1U5 NM_021137.4  
GAGTCCGCTGGCCACCCAGCTGAGAGGAGAGGCGCCCCCGGGGACGCACTGAGATTATGA
HKR056953 ARe42G09 pKA1U5 NM_021137.4  
GGTCCGCTGGCCACCCAGCTGAGAGGAGAGGCGCCCCCGGGGACGCACTGAGATTATGAG
HKR235053 ARiS087K13 pGCAP10 NM_021137.4  
GACAGCTTGGGACTGCTGAGGGGCAGGCGGCTGCAGGCTAGGGGCGGCTCGGAGTCCGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl