Prev. |  KEGG KO K06087 > 

RIKEN DNA Bank Human Resource - CLDN5

Gene ID NCBI Gene 7122 |  KEGG hsa:7122
Gene Symbol CLDN5
Protein Name claudin 5
Synonyms AWAL|BEC1|CPETRL1|TMDVCF|TMVCF
Ortholog resource in our bank

  CLDN5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB02846 pEAK-Claudin-5 Human claudin-5 cDNA

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX025958 IRAK064O22 pCMV-SPORT6 BC032363 NM_003277 Full
HGY080622 IRAL001J06 pOTB7 BC002404 NM_003277 Full
HGY083746 IRAL009G02 pOTB7 BC019290 NM_003277 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE021310 W01A053E14 pENTR-TOPO flj0007e03 AK092561 NM_003277  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR364809 RBd12A09 pGCAP10 NM_003277.3  
GGAGGTGCGACAGACCCGCGGGGCAAACGGACTGGGGCCAAGAGCCGGGAGCGCGGGCGC
HKR384435 RBd61B11 pGCAP10 NM_003277.3  
GAGACCTAGGAGGTGCGACAGACCCGCGGGGCAAACGGACTGGGGCCAAGAGCCGGGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl