Prev. | 

RIKEN DNA Bank Human Resource - TMPO

Gene ID NCBI Gene 7112 |  KEGG hsa:7112
Gene Symbol TMPO
Protein Name thymopoietin
Synonyms CMD1T|LAP2|LEMD4|PRO0868|TP
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX046321 IRAK115N09 pCMV-SPORT6 BC053675 NM_001032283 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE009432 W01A023J16 pENTR-TOPO IRAK115N09 BC053675 NM_001032283  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR053701 ARe34E05 pKA1U5 NM_003276.1  
GGGCGAAGCAGGCTGCTCGCCTCCTGCCTGTAGCTGTGTGGGCTGGGGTTGGTGCGAGCT
HKR370931 RBd27F11 pGCAP10 NM_003276.1  
GGGGGTTGGTGCGAGCTTCCAGCTTGGCCGCAGTTGGTTCGTAGTTCGGCTCTGGGGTCT
HKR374553 RBd36G09 pGCAP10 NM_003276.1  
AGGAAGCAGGCTGCTCGCCTCCTGCCTGTAGTGTGTGGGCTGGGGTTGGTGCGAGCTTCC
HKR390483 RBd76D11 pGCAP10 NM_003276.1  
GGCAGTTGGTTCGTAGTTCGGCTCTGGGGTCTTTTGTGTCCGGGTCTGGCTTGGCTTTGT
HKR397207 RBd93A07 pGCAP10 NM_003276.1  
GCCCGTCTAAACGCCCGCTGCAGGCGGCTGGTGGTCCAGGGAAGCGGCGTCGACTGCGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl