Prev. |  KEGG KO K06271 > 

RIKEN DNA Bank Human Resource - TLN1

Gene ID NCBI Gene 7094 |  KEGG hsa:7094
Gene Symbol TLN1
Protein Name talin 1
Synonyms ILWEQ|TLN|talin-1
Ortholog resource in our bank

  TLN1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE080829 M01C002B05 pDONR221 04-134-2_1-G03 BC042923 NM_006289  
HGE080877 M01C002D05 pDONR221 04-134-2_1-G03 BC042923 NM_006289  
HGE080925 M01C002F05 pDONR221 04-134-2_1-G03 BC042923 NM_006289  
HGE080973 M01C002H05 pDONR221 04-134-2_1-G03 BC042923 NM_006289  
HGE081021 M01C002J05 pDONR221 04-134-2_1-G03 BC042923 NM_006289  
HGE081069 M01C002L05 pDONR221 04-134-2_1-G03 BC042923 NM_006289  
HGE081117 M01C002N05 pDONR221 04-134-2_1-G03 BC042923 NM_006289  
HGE081165 M01C002P05 pDONR221 04-134-2_1-G03 BC042923 NM_006289  
HGE110401 M01C076A01 pDONR221 06-2_01-E01 BC042923 NM_006289  
HGE094410 M01C036A10 pDONR221 MGC07-F05 BC042923 NM_006289  
HGE094458 M01C036C10 pDONR221 MGC07-F05 BC042923 NM_006289  
HGE094506 M01C036E10 pDONR221 MGC07-F05 BC042923 NM_006289  
HGE094554 M01C036G10 pDONR221 MGC07-F05 BC042923 NM_006289  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR326009 RBb15A09 pKA1U5 NM_006289.2  
GGCCCGCGGGTGGGGGACGTTCCCAGGACGGAAGTGGCCGAGAGAGTGTCGAAGGGAGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl