Prev. |  KEGG KO K06514 > 

RIKEN DNA Bank Human Resource - THY1

Gene ID NCBI Gene 7070 |  KEGG hsa:7070
Gene Symbol THY1
Protein Name Thy-1 cell surface antigen
Synonyms CD90|CDw90
Ortholog resource in our bank

  THY1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03520 pAxCALNLhTHY1 (forward) Shuttle vector to generate rAd harboring human THY1 (forward)
RDB05155 pAxCALNLhTHY1 (forward) Shuttle vector to generate rAd harboring human THY1 (forward)
RDB05181 pAxCALNLhTHY1 (forward) Shuttle vector to generate rAd harboring human THY1 (forward)
RDB05182 pAxCALNLhTHY1 (reverse) Shuttle vector to generate rAd harboring human THY1 (reverse)
RDB05239 pAxCALNLhTHY1(forward) Shuttle vector to generate rAd expressing human THY1
RDB05240 pAxCALNLhTHY1(reverse) Shuttle vector to generate rAd expressing human THY1
RDB05244 pAxCALNLhTHY1(forward) Shuttle vector to generate rAd expressing human THY1
RDB05245 pAxCALNLhTHY1(reverse) Shuttle vector to generate rAd expressing human THY1
RDB07635 pTarget-hThy-1 Expression vector of human Thy-1

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX056188 IRAK140H20 pCMV-SPORT6 BC065559 NM_006288 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR342829 RBb57B05 pGCAP1 NM_006288.3  
GAACCGGAGGCGGCGGCGCGTCTGGAGGAGGCTGCAGCAGCGGAAGACCCCAGTCCAGAT
HKR385683 RBd64D11 pGCAP10 NM_006288.3  
GCTTTTCCTCCATGTCGCCACCGAGGTGGACGAGGCTGCACTTCTCCGCCGCCTCCGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.08.17

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl