Prev. |  KEGG KO K04659 > 

RIKEN DNA Bank Human Resource - THBS3

Gene ID NCBI Gene 7059 |  KEGG hsa:7059
Gene Symbol THBS3
Protein Name thrombospondin 3
Synonyms TSP3
Ortholog resource in our bank

  THBS3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY096305 IRAL040M17 pOTB7 BC018786 NM_007112 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR461760 RBdS154G16 pGCAP10 NM_007112.3  
GTGGCCTGCCAGGGGTAGTGAGCCGGCTGAGAGGCATGGAGACGCAGGAACTTCGGGGGG
HKR474992 RBdS187H24 pGCAP10 NM_007112.3  
GAGTGAGCCGGCTGAGAGGCATGGAGACGCAGGAACTTCGGGGGGCCCTGGCTCTTCTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl