Prev. |  KEGG KO K13375 > 

RIKEN DNA Bank Human Resource - TGFB1

Gene ID NCBI Gene 7040 |  KEGG hsa:7040
Gene Symbol TGFB1
Protein Name transforming growth factor beta 1
Synonyms CED|DPD1|IBDIMDE|LAP|TGF-beta1|TGFB|TGFbeta
Featured content Hippo signaling (human)
Featured content Endocytosis (human)
Featured content Intestinal immune network for IgA production - human
Ortholog resource in our bank

  TGFB1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX010917 IRAK027E21 pCMV-SPORT6 BC022242 NM_000660 Full/var
HGY082506 IRAL006E10 pOTB7 BC001180 NM_000660 Full/var
HGY082507 IRAL006E11 pOTB7 BC000125 NM_000660 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR182831 ARi57B07 pGCAP10 NM_000660.4  
GCCCGCCGCCGCCGCCCTTCGCGCCCTGGGCCATCTCCCTCCCACCTCCCTCCGCGGAGC
HKR376852 RBd42C04 pGCAP10 NM_000660.4  
GCTCCCTCCCACCTCCCTCCGCGGAGCAGCCAGACAGCGAGGGCCCCGGCCGGGGGCAGG
HKR388932 RBd72F12 pGCAP10 NM_000660.4  
GGCCGCCTCCCCCATGCCGCCCTCCGGGCTGCGGCTGCTGCTGCTGCTGCTACCGCTGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl