Prev. |  KEGG KO K04683 > 

RIKEN DNA Bank Human Resource - TFDP1

Gene ID NCBI Gene 7027 |  KEGG hsa:7027
Gene Symbol TFDP1
Protein Name transcription factor Dp-1
Synonyms DILC|DP1|DRTF1|Dp-1
Ortholog resource in our bank

  TFDP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY030129 IRAK075F09 pBluescriptR BC036601 NM_007111
HGY091095 IRAL027M07 pOTB7 BC011685 NM_007111

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE001681 W01A004D09 pENTR-TOPO IRAL027M07 BC011685 NM_007111  
HGE001683 W01A004D11 pENTR-TOPO IRAL027M07 BC011685 NM_007111  
HGE001685 W01A004D13 pENTR-TOPO IRAL027M07 BC011685 NM_007111  
HGE001687 W01A004D15 pENTR-TOPO IRAL027M07 BC011685 NM_007111  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR363707 RBd09E11 pGCAP10 NM_007111.3  
GGCACGTCACGCCGGCCCGACGCTCGGCCAGGGTGAGCCCCGCGTCCCGGCGCCACTCGG
HKR364572 RBd11H04 pGCAP10 NM_007111.3  
GGGCGAGGCGACTGAAAATCCTGAGTGTGGGAGTCGGTTTGGCCAGCTCCGCTCTCAGGA
HKR406223 RBdS015J07 pGCAP10 NM_007111.3  
GCACGTNNNNCCGGCCCTACNCTCNACCAGGGTGAGCCCNGNGTCCCGGCGCCGCTCGGG
HKR444364 RBdS110P04 pGCAP10 NM_007111.3  
GNCTCGGCCCANGGCAGGGACCCCGCCACNGCCGGGACCGCCCGGCCCGGCCCCAGCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl