Prev. |  KEGG KO K08548 > 

RIKEN DNA Bank Human Resource - NR2F2

Gene ID NCBI Gene 7026 |  KEGG hsa:7026
Gene Symbol NR2F2
Protein Name nuclear receptor subfamily 2 group F member 2
Synonyms ARP-1|ARP1|CHTD4|COUPTF2|COUPTFB|COUPTFII|NF-E3|SVP40|TFCOUP2
Ortholog resource in our bank

  NR2F2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX016897 IRAK042E01 pCMV-SPORT6 BC034585 NM_021005 Partial
HGY030429 IRAK076B05 pBluescriptR BC033957 NM_021005
HGY093618 IRAL034A18 pOTB7 BC014664 NM_021005 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE018246 W01A045K06 pENTR-TOPO IRAL034A18 BC014664 NM_021005  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR058532 ARe46F12 pKA1U5 NM_021005.3  
TTTGTGTGTGTGCGTGCGCGCGATGTGTGTTTTCTTCTTCTCCTCCTCCTCTCCCCGAGT
HKR167259 ARi18C11 pGCAP10 NM_021005.3  
GAGTGAGCTGATCGCGGAGAAGCCACTTCTGCCAGCCCCGGCGCCTATAAATCGCATTCC
HKR184425 ARi61B01 pGCAP10 NM_021005.3  
GGGAGAAGCCACTTCTGCCAGCCCCGGCGCCTATAAATCGCATTCCCTCCCGCGCCCCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl