Prev. |  KEGG KO K11830 > 

RIKEN DNA Bank Human Resource - TFAM

Gene ID NCBI Gene 7019 |  KEGG hsa:7019
Gene Symbol TFAM
Protein Name transcription factor A, mitochondrial
Synonyms MTDPS15|MTTF1|MTTFA|TCF6|TCF6L1|TCF6L2|TCF6L3
Featured content Huntington disease - human
Ortholog resource in our bank

  TFAM

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04444 SEREX clone BRC-Co-8 #1 SEREX clone BRC-Co-8 #1

webcatalog20220516.tab


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR066849 ARe67C01 pKA1U5 NM_003201.1  
ATCCTGGGTGCCTCGCTAGTGGCGGGCATGATAACACACGCCGGAGGGTCGCACGCGGGT
HKR068408 ARe71A08 pKA1U5 NM_003201.1  
GGATTTCCCATAGTGCCTCGCTAGTGGCGGGCATGATAACACACGCCGGAGGGTCGCACG
HKR247418 ARiS118J02 pGCAP10 NM_003201.1  
GGCGGGTTCCAGTTGTGATTGCTGGAGTTGTGTATTGCCAGGAGGCTCTCCGAGATTGGG
HKR325297 RBb13E01 pKA1U5 NM_003201.1  
GAGTGGCGGGCATGATAACACACGCCGGAGGGTCGCACGCGGGTTCCAGTTGTGATTGCT
HKR342171 RBb55H03 pGCAP1 NM_003201.1  
AGATTTCCCATAGTGCCTCGCTAGTGGCGGGCATGATAACACACGCCGGAGGGTCGCACG
HKR379349 RBd48G05 pGCAP10 NM_003201.1  
GATGATAACACACGCCGGAGGGTCGCACGCGGGTTCCAGTTGTGATTGCTGGAGTTGTGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl