Prev. |  KEGG KO K09448 > 

RIKEN DNA Bank Human Resource - TEAD4

Gene ID NCBI Gene 7004 |  KEGG hsa:7004
Gene Symbol TEAD4
Protein Name TEA domain transcription factor 4
Synonyms EFTR-2|RTEF1|TCF13L1|TEF-3|TEF3|TEFR-1|hRTEF-1B
Ortholog resources KEGG ortholog (KEGG orthology K09448) in the DNA Bank
Featured content Hippo signaling (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX009065 IRAK022L01 pCMV-SPORT6 BC015497 NM_201443 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE009369 W01A023H01 pENTR-TOPO IRAK022L01 BC015497 NM_201443 done
HGE009371 W01A023H03 pENTR-TOPO IRAK022L01 BC015497 NM_201443  
HGE009375 W01A023H07 pENTR-TOPO IRAK022L01 BC015497 NM_201443  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR208017 ARiS020A17 pGCAP10 NM_003213.2  
GGCACACTCGAGGCCAGGGGGCGGGAGGGCCGCANCTCCGGCGCCGCCGCGTCCCGCCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl