Prev. |  KEGG KO K03386 > 

RIKEN DNA Bank Human Resource - PRDX2

Gene ID NCBI Gene 7001 |  KEGG hsa:7001
Gene Symbol PRDX2
Protein Name peroxiredoxin 2
Synonyms HEL-S-2a|NKEF-B|NKEFB|PRP|PRX2|PRXII|PTX1|TDPX1|TPX1|TSA
Ortholog resources KEGG ortholog (KEGG orthology K03386) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY031048 IRAK077K08 pBluescriptR BC039428 NM_181738
HGX056415 IRAK141A15 pCMV-SPORT6 BC064138 NM_181738 Full
HGY080535 IRAL001F15 pOTB7 BC000452 NM_181738
HGY083775 IRAL009H07 pOTB7 BC003022 NM_181738

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE096048 M01C040B24 pDONR221 MGC09-H12 BC064138 NM_181738  
HGE096096 M01C040D24 pDONR221 MGC09-H12 BC064138 NM_181738  
HGE096144 M01C040F24 pDONR221 MGC09-H12 BC064138 NM_181738  
HGE096192 M01C040H24 pDONR221 MGC09-H12 BC064138 NM_181738  
HGE096240 M01C040J24 pDONR221 MGC09-H12 BC064138 NM_181738  
HGE096288 M01C040L24 pDONR221 MGC09-H12 BC064138 NM_181738  
HGE096336 M01C040N24 pDONR221 MGC09-H12 BC064138 NM_181738  
HGE096384 M01C040P24 pDONR221 MGC09-H12 BC064138 NM_181738  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042006 ARe05A06 pKA1U5 NM_005809.4  
GGCCGTGCACGTCTTGGTTCGGGCCGGGCATAAAAGGCTTCGCGGCCCAGGGCTCACTTG
HKR048803 ARe22A03 pKA1U5 NM_005809.4  
GAGGGGCTCACTTGGCGCTGAGAACGCGGGTCCACGCGTGTGATCGTCCGTGCGTCTAGC
HKR064860 ARe62C12 pKA1U5 NM_005809.4  
GGGCGCTGAGAACGCGGGTCCACGCGTGTGATCGTCCGTGCGTCTAGCCTTTGCCCACGC
HKR160570 ARi01H02 pGCAP10 NM_005809.4  
GGGCGCTGAGAACGCGGGTCCACGCGTGTGATCGTCCGTGCGTCTAGCCTTTGCCCACGC
HKR165259 ARi13C11 pGCAP10 NM_005809.4  
GGGCGCTGAGAACGCGGGTCCACGCGTGTGATCGTCCGTGCGTCTAGCCTTTGCCCACGC
HKR180078 ARi50D06 pGCAP10 NM_005809.4  
GACTTGGCGCTGAGAACGCGGGTCCACGCGTGTGATCGTCCGTGCGTCTAGCCTTTGCCC
HKR238509 ARiS096E13 pGCAP10 NM_005809.4  
GGGTTCGGGCCGGGCATAAAAGGCTTCGCGGCCCAGGGCTCACTTGGCGCTGAGAACGCG
HKR243823 ARiS109J07 pGCAP10 NM_005809.4  
GGCNCTCNNANCGCGGGTCCACGCNTGNGATCGNNCGTGCGTNTNNCCTTTGCCCACNCA
HKR326082 RBb15D10 pKA1U5 NM_005809.4  
GCCGCGCCGTGCACGTCTTGGTTCGGGCCGGGCATAAAAGGCTTCGCGGCCCAGGGCTCA
HKR326549 RBb16G05 pKA1U5 NM_005809.4  
GGGCGCTGAGAACGCGGGTCCACGCGTGTGATCGTCCGTGCGTCTAGCCTTTGCCCACGC
HKR326883 RBb17D11 pKA1U5 NM_005809.4  
GTGGCGCTGAGAACGCGGGTCCACGCGTGTGATCGTCCGTGCGTCTAGCCTTTGCCCACG
HKR327280 RBb18D08 pKA1U5 NM_005809.4  
GGGCGCTGAGAACGCGGGTCCACGCGTGTGATCGTCCGTGCGTCTAGCCTTTGCCCACGC
HKR332410 RBb31A10 pGCAP1 NM_005809.4  
GTTCGCGGCCCAGGGCTCACTTGGCGCTGAGAACGCGGGTCCACGCGTGTGATCGTCCGT
HKR332453 RBb31C05 pGCAP1 NM_005809.4  
HKR332573 RBb31H05 pGCAP1 NM_005809.4  
TTGGCGCTGAGAACGCGGGTCCACGCGNTGATGTATCGTCCGCTGCGTTCTAGCCTTTGC
HKR333205 RBb33A05 pGCAP1 NM_005809.4  
GGGCGCTGAGAACGCGGGTCCACGCGTGTGATCGTCCGTGCGTCTAGCCTTTGCCCACGC
HKR334105 RBb35E09 pGCAP1 NM_005809.4  
GGGCGCTGAGAACGCGGGTCCACGCGNTGTGATCGTCCGTGCGTTCTAGCCTTTGCCCAC
HKR339280 RBb48D08 pGCAP1 NM_005809.4  
GCTCCCCCGCGCCGATGCA.CGTCTTGGTTCGGGCCGGGCATAAAAGGCTTCGCGGCCCA
HKR342008 RBb55A08 pGCAP1 NM_005809.4  
GGGCGCTGAGAACGCGGGTCCACGCGTGCTGATCGTCCGTGCGTCTAGCCTTTGCCCACG
HKR346454 RBb66C06 pGCAP1 NM_005809.4  
GTCCCTCCCCCGCGCCGTGCACGTCTTGGTTCGGGCCGGGCATAAAAGGCTTCGCGGCCC
HKR367699 RBd19E03 pGCAP10 NM_005809.4  
GATAAAAAGGCTTCGCGGCCCAGGGCTCACTTGGCGCTGAGAACGCGGGTCCACGCGTGT
HKR375349 RBd38G05 pGCAP10 NM_005809.4  
GGGCGCTGAGAACGCGGGTCCACGCGTGTGATCGTCCGTGCGTCTAGCCTTTGCCCACGC
HKR382929 RBd57F09 pGCAP10 NM_005809.4  
GGGCGCTGAGAACGCGGGTCCACGCGTGTGATCGTCCGTGCGTCTAGCCTTTGCCCACGC
HKR383350 RBd58G06 pGCAP10 NM_005809.4  
GGCGCGGCCCAGGGCTCACTTGGCGCTGAGAACGCGGGTCCNNGNNTGTGATCGTCCGTG
HKR390006 RBd75A06 pGCAP10 NM_005809.4  
GGCCCAGGGCTCACTTGGCGCTGAGAACGCGGGTCCACGCGTGTGATCGTCCGTGCGTCT
HKR402959 RBdS007G15 pGCAP10 NM_005809.4  
GGGCGCTGAGAACGCGGGTCCACGCGTGTGATCGTCCGTGCGTCTAGCCTTTGCCCACGC
HKR406017 RBdS015A17 pGCAP10 NM_005809.4  
GGGCGCTGAGAACGCGGGTCCACGCGTGTGATCGTCCGTGCGTCTAGCCTTTGCCCACGC
HKR406137 RBdS015F17 pGCAP10 NM_005809.4  
GGGCGCTGAGAACGCGGGTCCACGCGTGTGATCGTCCGTGCGTCTAGCCTTTGCCCACGC
HKR428368 RBdS070P08 pGCAP10 NM_005809.4  
GGCGCTGAGAACGCGGGTCCACGCGTGTGATCGTCCGTGCGTCTAGCCTTTGCCCACGCA
HKR430358 RBdS075O22 pGCAP10 NM_005809.4  
CGGCCGGCCGATGGGCGCTGAGAACGCGGGTCCACGCGTGTGATCGTCCGTGCGTCTAGC
HKR432491 RBdS081D19 pGCAP10 NM_005809.4  
GACCGCTCCGCTCGTCCGCTCCCTCCCCCGCGCCGTGCACGTCTTGGTTCGGGCCGGGCA
HKR461625 RBdS154B01 pGCAP10 NM_005809.4  
GGGCGCTNAGANCNNNGGTCCCCGCGTGNGATCGTCCGTGCGTCTAGCCTTTGCCCACTC
HKR471162 RBdS177P02 pGCAP10 NM_005809.4  
GTGGCGCTGANAACNCGGGTCCACCCTTGTGATCNTCCGNGCGTCTAGCCTTTGCCCACG
HKR474840 RBdS187B16 pGCAP10 NM_005809.4  
GGGCGCTGAGAACGCGGGTCCACGCGTGTGATCGTCCGTGCGTCTAGCCTTTGCCCACGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl