Prev. |  KEGG KO K04491 > 

RIKEN DNA Bank Human Resource - TCF7L2

Gene ID NCBI Gene 6934 |  KEGG hsa:6934
Gene Symbol TCF7L2
Protein Name transcription factor 7 like 2
Synonyms TCF-4|TCF4
Featured content Hippo signaling (human)
Featured content Wnt signaling pathway (human)
Ortholog resource in our bank

  TCF7L2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027823 IRAK069J07 pCMV-SPORT6 BC032656 NM_030756 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR072569 ARe81H01 pKA1U5 NM_030756.3  
GTCAATAATCTCCGCTCCCAGACTACTCCGNTTCCTCCGGATTTCGATCCCCCTTTTTCT
HKR406227 RBdS015J11 pGCAP10 NM_030756.3  
GGCCATGTTAGCGGCCAAGAGGCAAGATGGAGGGCTCTTTAAGGGGCCACCGTATCCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl