Prev. | Human A to Z list > T > 

RIKEN DNA Bank Human Resource - TCEB2

Gene ID (NCBI) 6923
Gene Symbol TCEB2
Protein Name transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B)
Synonyms ELOB|SIII
Databases KEGG link 01 |  NCBI Gene link 01
Featured content HIF-1 signaling pathway - human


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX056051 IRAK140C03 pCMV-SPORT6 BC065000 NM_007108 Full
HGY084039 IRAL010B15 pOTB7 BC013306 NM_007108 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042180 ARe05H12 pKA1U5 NM_007108.2  
TGGCGCCGGCGCGTCGAGGGGAGAGGCAGCAGCCGCGATGGACGTGTTCCTCATGATCCG
HKR166908 ARi17E12 pGCAP10 NM_007108.2  
GAGAGGCAGCAGCCGCGATGGACGTGTTCCTCATGATCCGGCGCCACAAGACCACCATCT
HKR052525 ARe31F05 pKA1U5 NM_007108.2  
TTGGCGGCTGCGCCGGCGCGTCGAGGGGAGAGGCAGCAGCCGCGATGGACGTGTTCCTCA
HKR053209 ARe33A09 pKA1U5 NM_007108.2  
GAGAGGCAGCAGCCGCGATGGACGTGTTCCTCATGATCCGGCGCCACAAGACCACCATCT
HKR173302 ARi33E06 pGCAP10 NM_007108.2  
CGGCCGGCCGATGGCGTCGAGGGGAGAGGCAGCAGCCGCGATGGACGTGTTCCTCATGAT
HKR175701 ARi39E05 pGCAP10 NM_007108.2  
GGCGTCGAGGGGAGAGGCAGCAGCCGCGATGGACGTGTTCCTCATGATCCGGCGCCACAA
HKR179697 ARi49E01 pGCAP10 NM_007108.2  
GGCGCGGCTGCGCCGGCGCGTCGAGGGGAGAGGCAGCAGCCGCGATGGACGTGTTCCTCA
HKR061299 ARe53E03 pKA1U5 NM_007108.2  
GGGGGAGAGGCAGCAGCCGCGATGGACGTGTTCCTCATGATCCGGCGCCACAAGACCACC
HKR187257 ARi68C09 pGCAP10 NM_007108.2  
GGCGCCGGCGCGTCGAGGGGAGAGGCAGCAGCCGCGATGGACGTGTTCCTCATGATCCGG
HKR074932 ARe87F12 pKA1U5 NM_007108.2  
GGAACGGGGCGGAGCGCGGCTGCGCCGGCGCGTCGAGGGGAGAGGCAGCAGCCGCGATGG
HKR076507 ARe91E11 pKA1U5 NM_007108.2  
GGCGCCGGCGCGTCGAGGGGAGAGGCAGCAGCCGCGATGGACGTGTTCCTCATGATCCGG
HKR203301 ARiS008E05 pGCAP10 NM_007108.2  
GGGCAGCAGCCGCNNTGGACGTGTTCCTCATGATCCGGCGCCACAAGACCACCATCTTCA
HKR208153 ARiS020G09 pGCAP10 NM_007108.2  
GGGGAACGGGGCGGAGCGCGGCTGCGCCGGCGCGTCGAGGGGAGAGGCAGCAGCCGCGAT
HKR248996 ARiS122I04 pGCAP10 NM_007108.2  
GGCCGGCGCGTCGAGGGGAGAGGCAGCAGCCGCGATGGACGTGTTCCTCATGATCCGGCG
HKR279429 ARiS198J13 pGCAP10 NM_007108.2  
GGCGGCTGCGCCGGCGCGTCGAGGGGAGAGGCAGCAGCCGCGATGGACGTGTTCCTCATG
HKR368476 RBd21D04 pGCAP10 NM_007108.2  
GAGGGGAGAGGCAGCAGCCGCGATGGACGTGTTCCTCATGATCCGGCGCCACAAGACCAC
HKR376573 RBd41H05 pGCAP10 NM_007108.2  
GGCGCCGGCGCGTCGAGGGGAGAGGCAGCAGCCGCGATGGACGTGTTCCTCATGATCCGG
HKR379699 RBd49E03 pGCAP10 NM_007108.2  
GGCGCGGCTGCGCCGGCGCGTCGAGGGGAGAGGCAGCAGCCGCGATGGACGTGTTCCTCA
HKR399682 RBd99D10 pGCAP10 NM_007108.2  
GGGGAGAGGCAGCAGCCGCGATGGACGTGTTCCTCATGATCCGGCGCCACAAGACCACCA
HKR452833 RBdS132B09 pGCAP10 NM_007108.2  
GGCGGGGCATGCTGGGCCACGCGCGGGCTGCCGGGAACGGGGCGGAGCGCGGCTGCGCCG
HKR452945 RBdS132G01 pGCAP10 NM_007108.2  
GGCGGGGCATGCTGGGCCACGCGCGGGCTGCCGGGAACGGGGCGGAGCGCGGCTGCGCCG
HKR474876 RBdS187D04 pGCAP10 NM_007108.2  
GGCGGCTGCGCCGGCGCGTCGAGGGGAGAGGCAGCAGCCGCGATGGACGTGTTCCTCATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.02.17

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl