Prev. | Human A to Z list > T > 

RIKEN DNA Bank Human Resource - TCEB1

Gene ID (NCBI) 6921
Gene Symbol TCEB1
Protein Name transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C)
Synonyms SIII|eloC
Databases KEGG link 01 |  NCBI Gene link 01
Featured content HIF-1 signaling pathway - human


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX010477 IRAK026D05 pCMV-SPORT6 BC013809 NM_005648 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE000555 W01A001G11 pENTR-TOPO IRAK026D05 BC013809 NM_005648  
HGE000559 W01A001G15 pENTR-TOPO IRAK026D05 BC013809 NM_005648  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR173771 ARi34H03 pGCAP10 NM_005648.2  
GAGACGGAAGTGAGCGACACACTCTGCGTCCTCGCCTCACCAGGAAACTACTAAAGTTCC
HKR234988 ARiS087H20 pGCAP10 NM_005648.2  
GCGACTGCCCCGGAACCCACCGGAGCAGGCAGCTGGGGGTGGGGGGGCGGNCNTGNCATA
HKR235028 ARiS087J12 pGCAP10 NM_005648.2  
GACACTCTGCGTCCTCGCCTCACCAGGTACGGATCTCCCGCGCGTCGCCGAAAGCGGCTC
HKR325604 RBb14A04 pKA1U5 NM_005648.2  
GAGGGGCTGTGGCAGTACGCGGGGACCCGGCTGCGGTGGCTGCGGGACTGACGAGAAACT
HKR336501 RBb41E05 pGCAP1 NM_005648.2  
GGATAGGGGCTGTGGCAGTACGCGGGGACCCGGCTGCGGTGGCTGCGGGACTGACGAGAA
HKR385249 RBd63C01 pGCAP10 NM_005648.2  
GACTCTGCGTCCTCGCCTCACCAGGAAACTACTAAAGTTCCTGGGGAAGCAAAGTAGAAT
HKR388057 RBd70C09 pGCAP10 NM_005648.2  
GAGACGGAAGTGAGCGACACACTCTGCGTCCTCGCCTCACCAGAGTCTTGCTGTGTGGCC
HKR402878 RBdS007D06 pGCAP10 NM_005648.2  
GAACCCACCGGAGCAGGCAGCTGGGGGTGGGGGGGCGGCCCTGGGATAGGGGCTGTGGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.02.17

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl