Prev. | 

RIKEN DNA Bank Human Resource - TBCE

Gene ID NCBI Gene 6905 |  KEGG hsa:6905
Gene Symbol TBCE
Protein Name tubulin folding cofactor E
Synonyms HRD|KCS|KCS1|PEAMO|pac2
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005492 IRAK013M04 pCMV-SPORT6 BC008654 NM_003193 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR044007 ARe10A07 pKA1U5 NM_003193.3  
GAGTTGGCTGGAGGGGCTGCTGCTGGGAACACCTGGAGTCTCCGCGGGCAGATCTCATAT
HKR395348 RBd88G04 pGCAP10 NM_003193.3  
TTGAGTTGGCTGGAGGGGCTGCTGCTGGGAACACCTGGAGTCTCCGCGGGCAGATCTCAT
HKR402836 RBdS007B12 pGCAP10 NM_003193.3  
GGCCAGAGCCTCAAGCTTCGCTGCTGGGCAGTTGGCTGGAGGGGCTGCTGCTGGGAACAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl