Prev. | 

RIKEN DNA Bank Human Resource - TBCC

Gene ID NCBI Gene 6903 |  KEGG hsa:6903
Gene Symbol TBCC
Protein Name tubulin folding cofactor C
Synonyms CFC
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083567 IRAL008P07 pOTB7 BC020170 NM_003192 Full
HGY089215 IRAL023A15 pOTB7 BC017479 NM_003192 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE037649 W01A094C01 pENTR-TOPO IRAL023A15 BC017479 NM_003192  
HGE037651 W01A094C03 pENTR-TOPO IRAL023A15 BC017479 NM_003192  
HGE037657 W01A094C09 pENTR-TOPO IRAL023A15 BC017479 NM_003192  
HGE046689 W01A116M01 pENTR-TOPO IRAL023A15 BC017479 NM_003192  
HGE046691 W01A116M03 pENTR-TOPO IRAL023A15 BC017479 NM_003192  
HGE046711 W01A116M23 pENTR-TOPO IRAL008P07 BC020170 NM_003192  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR462713 RBdS156N01 pGCAP10 NM_003192.2  
GAGAGAGGAAGCTTGAAGCCAATATGGAGTCCGTCAGTTGCTCCGCTGCTGCTGTCAGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl