Prev. | 

RIKEN DNA Bank Human Resource - SYPL1

Gene ID NCBI Gene 6856 |  KEGG hsa:6856
Gene Symbol SYPL1
Protein Name synaptophysin like 1
Synonyms H-SP1|SYPL
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008819 IRAK022A19 pCMV-SPORT6 BC016835 NM_182715 Full
HGX054053 IRAK135C05 pCMV-SPORT6 BC061887 NM_182715 Full
HGY094298 IRAL035M10 pDNR-LIB BC020938 NM_182715 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR068950 ARe72G06 pKA1U5 NM_006754.2  
GCCTTTCCTCAGAGGATGTCCGGCTTCCAGATCACCCTCAACCCGCTCAAGGAGCCACTC
HKR166029 ARi15B05 pGCAP10 NM_006754.2  
CGGCCGGCCGATGCCCCTCCTCCGCCCCGTCGTCCTGACTCTCTCTCCCTCCTTTCCT
HKR238612 ARiS096I20 pGCAP10 NM_006754.2  
GGCCACCGGGCTGCTCTGGTCTCGTCGGTCCCCTCCTCCGCCCCGTCGTCCTGACTCTCT
HKR433558 RBdS083O22 pGCAP10 NM_006754.2  
GGCCACCGGGCTGCTCTGGTCTCGTCGGTCCCCTCCTCCGCCCCGTCGTCCTGACTCTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl