Prev. |  KEGG KO K14998 > 

RIKEN DNA Bank Human Resource - SURF1

Gene ID NCBI Gene 6834 |  KEGG hsa:6834
Gene Symbol SURF1
Protein Name SURF1 cytochrome c oxidase assembly factor
Synonyms CMT4K
Ortholog resource in our bank

  SURF1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX020222 IRAK050J06 pCMV-SPORT6 BC028314 -
HGX066757 IRAK166O21 pCMV-SPORT6 BC071658 -

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE046001 W01A115A01 pENTR-TOPO IRAK050J06 BC028314 -  
HGE046003 W01A115A03 pENTR-TOPO IRAK050J06 BC028314 -  
HGE046007 W01A115A07 pENTR-TOPO IRAK050J06 BC028314 -  
HGE046011 W01A115A11 pENTR-TOPO IRAK050J06 BC028314 -  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR046929 ARe17F09 pKA1U5 NM_003172.2  
GGCGATGGCGGCGGTGGCTGCGTTGCAGCTGGGGCTGCGGGCGGCGGGGCTGGGACGGGC
HKR078857 ARe97C09 pKA1U5 NM_003172.2  
GGGGGCCGGGTGCGATGGCGGCGGTGGCTGCGTTGCAGCTGGGGCTGCGGGCGGCGGGGC
HKR362500 RBd06E04 pGCAP10 NM_003172.2  
GGGGGCCGGGTGCGATGGCGGCGGTGGCTGCGTTGCAGCTGGGGCTGCGGGCGGCGGGGC
HKR405307 RBdS013E11 pGCAP10 NM_003172.2  
GTCTCCTGCGTCCCGGAAGCGCCCGCGGGGCCGGGTGCGATGGCGGCGGTGGCTGCGTTG
HKR405308 RBdS013E12 pGCAP10 NM_003172.2  
GAGCGCCCGCGGGGCCGGGTGCGATGGCGGCGGTGGCTGCGTTGCAGCTGGGGCTGCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl