Prev. |  KEGG KO K17675 > 

RIKEN DNA Bank Human Resource - SUPV3L1

Gene ID NCBI Gene 6832 |  KEGG hsa:6832
Gene Symbol SUPV3L1
Protein Name Suv3 like RNA helicase
Synonyms SUV3
Ortholog resource in our bank

  SUPV3L1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY019489 IRAK048M01 pBluescriptR BC036112 NM_003171 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE090027 M01C025B03 pDONR221 MGC02-C02 BC036112 NM_003171  
HGE090075 M01C025D03 pDONR221 MGC02-C02 BC036112 NM_003171  
HGE090123 M01C025F03 pDONR221 MGC02-C02 BC036112 NM_003171  
HGE090171 M01C025H03 pDONR221 MGC02-C02 BC036112 NM_003171  
HGE090219 M01C025J03 pDONR221 MGC02-C02 BC036112 NM_003171  
HGE090267 M01C025L03 pDONR221 MGC02-C02 BC036112 NM_003171  
HGE090315 M01C025N03 pDONR221 MGC02-C02 BC036112 NM_003171  
HGE090363 M01C025P03 pDONR221 MGC02-C02 BC036112 NM_003171  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR366402 RBd16A02 pGCAP10 NM_003171.3  
GACCTGCGGCCTCGATGTCCTTCTCCCGTGCCCTATTGTGGGCTCGGCTCCCGGCGGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl