Prev. |  KEGG KO K15301 > 

RIKEN DNA Bank Human Resource - STXBP3

Gene ID NCBI Gene 6814 |  KEGG hsa:6814
Gene Symbol STXBP3
Protein Name syntaxin binding protein 3
Synonyms MUNC18-3|MUNC18C|PSP|UNC-18C
Ortholog resource in our bank

  STXBP3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013520 IRAK033N08 pBluescriptR BC038099 NM_007269 Full/var
HGX025059 IRAK062K19 pCMV-SPORT6 BC028028 NM_007269 Partial
HGX039210 IRAK098A10 pCMV-SPORT6 BC047764 NM_007269 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR076029 ARe90B05 pKA1U5 NM_007269.2  
GGGAAGGTGGTGGCTGCTGCTCCGCAGTGTGGGGAAGATGGCGCCGCCGGTGGCAGAGAG
HKR208221 ARiS020J05 pGCAP10 NM_007269.2  
AGGTTGGGAGTGGAAGGTGGTGGCTGCTGCTCCGCAGTGTGGGGAAGATGGCGCCNCCGG
HKR208314 ARiS020N02 pGCAP10 NM_007269.2  
AGGTTGGGAGTGGAAGGTGGTGGCTGCTGCTCCGCAGTGTGGGGAAGATGGCGCCGCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl