Prev. |  KEGG KO K08486 > 

RIKEN DNA Bank Human Resource - STX3

Gene ID NCBI Gene 6809 |  KEGG hsa:6809
Gene Symbol STX3
Protein Name syntaxin 3
Synonyms STX3A
Ortholog resource in our bank

  STX3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081560 IRAL003O24 pOTB7 BC007405 NM_004177
HGY084208 IRAL010I16 pOTB7 BC007429 NM_004177 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR162876 ARi07D04 pGCAP10 NM_004177.3  
GGGAGGCTCCCGTGGCCTCGGACGCTCCTCCTAGCTAGCGGCCGCCGCCCGCCGCCGCCT
HKR378449 RBd46C01 pGCAP10 NM_004177.3  
GGTGGCCTCGGACGCTCCTCCTAGCTAGCGGCCGCCGCCCGCCGCCGCCTGCGCCTCCAG
HKR380855 RBd52C07 pGCAP10 NM_004177.3  
GGGAGCGCGAGGCGCCGGTGGGGGCGGAGGGGGCTGCGCGGCGGAGGCTCCCGTGGCCTC
HKR416187 RBdS040H19 pGCAP10 NM_004177.3  
GAGTGCCAAGTGTCTCCACTGGCACTAACAACATCGAGCTGCTTACGTTTCTCGGAGCGG
HKR420554 RBdS051G10 pGCAP10 NM_004177.3  
GGGAGGGGGCTGCGCGGCGGAGGCTCCCGTGGCCTCGGACGCTCCTCCTAGCTAGCGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl