Prev. |  KEGG KO K04560 > 

RIKEN DNA Bank Human Resource - STX1A

Gene ID NCBI Gene 6804 |  KEGG hsa:6804
Gene Symbol STX1A
Protein Name syntaxin 1A
Synonyms HPC-1|P35-1|STX1|SYN1A
Ortholog resource in our bank

  STX1A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX055980 IRAK139P20 pCMV-SPORT6 BC064644 NM_004603 Full
HGY080491 IRAL001D19 pOTB7 BC000444 NM_004603 Full/var
HGY083625 IRAL009B01 pOTB7 BC003011 NM_004603 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE045968 W01A114P08 pENTR-TOPO IRAK139P20 BC064644 NM_004603  
HGE045970 W01A114P10 pENTR-TOPO IRAK139P20 BC064644 NM_004603  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR364434 RBd11B10 pGCAP10 NM_004603.2  
GACGGCTGCAGCCGGCGCCGCTGCCACTCCCGGGAGCATGAAGGACCGAACCCAGGAGCT
HKR370810 RBd27A10 pGCAP10 NM_004603.2  
GGCCGCTGCCACTCCCGGGAGCATGAAGGACCGAACCCAGGAGCTCCGCACGGCCAAGGA
HKR372508 RBd31E12 pGCAP10 NM_004603.2  
GACACGGCTGCAGCCGGCGCCGCTGCCACTCCCGGGAGCATGAAGGACCGAACCCAGGAG
HKR471182 RBdS177P22 pGCAP10 NM_004603.2  
GGGCGCCGCTGCCACTCCCGGGAGCATGAAGGACCGAACCCAGGAGCTCCGCACGGCCAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl