Prev. |  KEGG KO K09491 > 

RIKEN DNA Bank Human Resource - HSPA13

Gene ID NCBI Gene 6782 |  KEGG hsa:6782
Gene Symbol HSPA13
Protein Name heat shock protein family A (Hsp70) member 13
Synonyms STCH
Ortholog resources KEGG ortholog (KEGG orthology K09491) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY013880 IRAK034L16 pBluescriptR BC036370 NM_006948 Full/var
HGY092808 IRAL032A08 pDNR-LIB BC017580 NM_006948 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR205562 ARiS013P02 pGCAP10 NM_006948.4  
GACAGTCATCACAAGCCTGTTCGGCGGGACTGTGATGGCCAGAGAGATGACGATCTTAGG
HKR406191 RBdS015H23 pGCAP10 NM_006948.4  
GATCACAAGCCTGTTCGGCGGGACTGTGATGGCCAGAGAGATGACGATCTTAGGATCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl