Prev. |  KEGG KO K11224 > 

RIKEN DNA Bank Human Resource - STAT5B

Gene ID NCBI Gene 6777 |  KEGG hsa:6777
Gene Symbol STAT5B
Protein Name signal transducer and activator of transcription 5B
Synonyms STAT5
Featured content Jak-STAT signaling pathway (human)
Ortholog resource in our bank

  STAT5B

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB17322 CSU6EG_sh2-hSTAT5AB Short hairpin RNA (shRNA) lentivirus expression vector of human STAT5.

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX055628 IRAK139B04 pCMV-SPORT6 BC065227 NM_012448 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE011782 W01A029H14 pENTR-TOPO IRAK139B04 BC065227 NM_012448  
HGE011784 W01A029H16 pENTR-TOPO IRAK139B04 BC065227 NM_012448  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR361205 RBd03A05 pGCAP10 NM_012448.3  
GAACTCCGCGCGGCGGCCCGGCCGAGGGAGGGAGCGAGCGGGCGGGCGGGCAAGCCAGAC
HKR391656 RBd79C08 pGCAP10 NM_012448.3  
GGCCCCGGCGGGAGGAGAGTCGGCGGCCGGAGCCGTCACCCCGGGCGGGGACCCAGCGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl