Prev. |  KEGG KO K04218 > 

RIKEN DNA Bank Human Resource - SSTR2

Gene ID NCBI Gene 6752 |  KEGG hsa:6752
Gene Symbol SSTR2
Protein Name somatostatin receptor 2
Synonyms -
Ortholog resource in our bank

  SSTR2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07378 pGL4-phSSTR2 Promoter collection, Human SSTR2 promoter

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011612 IRAK029A12 pCMV-SPORT6 BC019610 NM_001050 Full
HGY082606 IRAL006I14 pOTB7 BC000256 NM_001050 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR370927 RBd27F07 pGCAP10 NM_001050.2  
GGCAGCCACCCATGCGCGCGCGCTCGCAAGACCACCAGCGCCCAGAGCCCCAGTCTGAGG
HKR452953 RBdS132G09 pGCAP10 NM_001050.2  
GAGTCCCAGCGGCGCAGCCACCCATGCGCGCGCGCTCGCAAGACCACCAGCGCCCAGAGC
HKR461659 RBdS154C11 pGCAP10 NM_001050.2  
GGAGGCTTGGCGCCGGGGGTCTGCGGGCGAGGGGAGCTCTCTACGTGCGAGGGGCTAGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl