Prev. |  KEGG KO K09272 > 

RIKEN DNA Bank Human Resource - SSRP1

Gene ID NCBI Gene 6749 |  KEGG hsa:6749
Gene Symbol SSRP1
Protein Name structure specific recognition protein 1
Synonyms FACT|FACT80|T160
Ortholog resource in our bank

  SSRP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083561 IRAL008P01 pOTB7 BC005116 NM_003146 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE002927 W01A007F07 pENTR-TOPO IRAL008P01 BC005116 NM_003146  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR041252 ARe03C04 pKA1U5 NM_003146.2  
TGGATCCTCTCTGTGGCCTGTGTACGGCTTCCGGTGGCGGGACGCGGGGCCGCGCACGCG
HKR068881 ARe72D09 pKA1U5 NM_003146.2  
GGCGGGACGCGGGGCCGCGCACGCGGGAAAAGCTTTCCCCGGNTGNTCCCCCCATCCCNN
HKR279414 ARiS198I22 pGCAP10 NM_003146.2  
CGGCCGGCCNNNGTCTCNGNGGCCNGTGTACGGCTTCCGGTGGCGGGACGCGGGGCCGCG
HKR347254 RBb68C06 pGCAP1 NM_003146.2  
TGGCGGGACGCGGGGCCGCGCACGCGGGAAAAGCTTCCCCGGTGTCCCCCCATCCCCCTC
HKR428163 RBdS070G19 pGCAP10 NM_003146.2  
GGGGACGCGGGGCCGCGCACGCGGGAAAAGCTTCCCCGGTGTCCCCCCATCCCNCAACCN

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl