Prev. |  KEGG KO K04571 > 

RIKEN DNA Bank Human Resource - SSR4

Gene ID NCBI Gene 6748 |  KEGG hsa:6748
Gene Symbol SSR4
Protein Name signal sequence receptor subunit 4
Synonyms CDG1Y|TRAPD
Ortholog resource in our bank

  SSR4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001219 IRAK003A19 pCMV-SPORT6 BC003371 NM_006280 Full
HGX008917 IRAK022E21 pCMV-SPORT6 BC015362 NM_006280 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE004078 W01A010D06 pENTR-TOPO IRAK003A19 BC003371 NM_006280  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR067780 ARe69H12 pKA1U5 NM_006280.1  
GCTTTTCCTCTAGGCAGAGAAGAGGCGATGGCGGCGATGGCATCTCTCGGCGCCCTGGCG
HKR170905 ARi27E09 pGCAP10 NM_006280.1  
GGTGTTCATGGGAGCTCGTTTTCTTTTCCTCTAGGCAGAGAAGAGGCGATGGCGGCGATG
HKR171680 ARi29D08 pGCAP10 NM_006280.1  
GGGGAGCTCGTTTTCTTTTCCTCTAGGCAGAGAAGAGGCGATGGCGGCGATGGCATCTCT
HKR209463 ARiS023K23 pGCAP10 NM_006280.1  
GCTTTTCCCNCTAGGCAGANAAANNNNCGATGGCGGCGATGGCATCTCTCGGCGCCCTGG
HKR238675 ARiS096L11 pGCAP10 NM_006280.1  
GCTTTTCCTCTAGGCAGAGAAGAGGCGATGGCGGCGATGGCATCTCTCGGCGCCCTGGCG
HKR345725 RBb64F05 pGCAP1 NM_006280.1  
AAATGTGCTCTAGGCAGAGAAGAGGCGATGGCGGCGATGGCATCTCTCGGCGCCCTGGCG
HKR363626 RBd09B02 pGCAP10 NM_006280.1  
GAGAGAAGAGGCGATGGCGGCGATGGCATCTCTCGGCGCCCTGGCGCTGCTCCTGCTGTC
HKR390876 RBd77D04 pGCAP10 NM_006280.1  
GAGGCAGAGAAGAGGCGATGGCGGCGATGGCATCTCTCGGCGCCCTGGCGCTGCTCCTGC
HKR405769 RBdS014H01 pGCAP10 NM_006280.1  
TTTTCTTTTCCTCTAGGCAGAGAAGAGGCGATGGCGGCGATGGCATCTCTCGGCGCCCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl