Prev. |  KEGG KO K13251 > 

RIKEN DNA Bank Human Resource - SSR3

Gene ID NCBI Gene 6747 |  KEGG hsa:6747
Gene Symbol SSR3
Protein Name signal sequence receptor subunit 3
Synonyms TRAPG
Ortholog resource in our bank

  SSR3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084841 IRAL012B17 pOTB7 BC017203 NM_007107 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE004597 W01A011I05 pENTR-TOPO IRAL012B17 BC017203 NM_007107  
HGE004599 W01A011I07 pENTR-TOPO IRAL012B17 BC017203 NM_007107  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR042927 ARe07F07 pKA1U5 NM_007107.2  
GCCCTGATTCTCGCCTGCAGCTCCGCCATGGCTCCTATAGGCAGCTCCAAACAGCAGTCT
HKR047323 ARe18F03 pKA1U5 NM_007107.2  
GCCCTGNTTCTCGCCTGCAGCTCCGCCATGGCTCCTAAAGGCAGCTCCAAACAGCAGTCT
HKR054403 ARe36A03 pKA1U5 NM_007107.2  
GAAGGGCCTTTGCCCGCCTTGGCGGCCGGCTCTACGTTCCCTGTTCTCGCCTGCAGCTCC
HKR079255 ARe98C07 pKA1U5 NM_007107.2  
GGCCTGCAGCTCCGCCATGGCTCCTAAAGGCAGCTCCAAACAGCAGTCTGAGGAGGACCT
HKR170170 ARi25H02 pGCAP10 NM_007107.2  
GAAAGGGAAAAAAAAAAAAAAAAAAACAAAAAAAANAAAANAAANAACANTNNNANANNN
HKR182805 ARi57A05 pGCAP10 NM_007107.2  
GNTTCTTTTGAGTNNCTCCGCCATGAATCCGTAAGGGGTCTCCTNTCGCAGCCTGAGGAG
HKR182829 ARi57B05 pGCAP10 NM_007107.2  
GGTTCTCGCCTGCAGCTCCGCCATGGCTCCTAAAGGCAGCTCCAAACAGCAGTCTGAGGA
HKR186552 ARi66G08 pGCAP10 NM_007107.2  
AACCCTGTTCTCGCCTGCAGCTCCGCCATGGCTCCTAAAGGCAGCTCCAAACAGCAGTCT
HKR218007 ARiS045A07 pGCAP10 NM_007107.2  
GGCCTGCAGCTCCGCCATGGCTCCTAAAGGCAGCTCCAAACAGCAGTCTGAGGAGGACCT
HKR264474 ARiS161D02 pGCAP10 NM_007107.2  
GGTTCCCTGTTCTCGCCTGCAGCTCCGCCATGGCTCCTAAAGGCAGCTCCAAACAGCAGT
HKR279433 ARiS198J17 pGCAP10 NM_007107.2  
GCNNGCCNGCAGCNNCGCCNNGGCTCCNAAAGGCAGCTCCAAACAGCAGTCTGAGGAGGA
HKR339252 RBb48C04 pGCAP1 NM_007107.2  
GGCCCGCCTTGGCGGCCGGCTCTACGTTCCCTGNTTCTCGCCTGCAGCTCCGCCATGGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl