Prev. |  KEGG KO K13249 > 

RIKEN DNA Bank Human Resource - SSR1

Gene ID NCBI Gene 6745 |  KEGG hsa:6745
Gene Symbol SSR1
Protein Name signal sequence receptor subunit 1
Synonyms TRAPA
Ortholog resource in our bank

  SSR1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086382 IRAL015P22 pOTB7 BC007710 NM_003144 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE005337 W01A013F17 pENTR-TOPO IRAL015P22 BC007710 NM_003144  
HGE005339 W01A013F19 pENTR-TOPO IRAL015P22 BC007710 NM_003144  
HGE005343 W01A013F23 pENTR-TOPO IRAL015P22 BC007710 NM_003144  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR047229 ARe18B05 pKA1U5 NM_003144.3  
GGCCATTACCGCCGGAGCCGCCGAGAGCCTTAGCCGACGGAAACTGGACACTGGACCGGC
HKR054429 ARe36B05 pKA1U5 NM_003144.3  
GGCCATTACCGCCGGAGCCGCCGAGAGCCTTANCCGACGGAAACTGGACACTGGACCGGC
HKR277826 ARiS194J10 pGCAP10 NM_003144.3  
GAGCCGACGGAAACTGGACACTGGACCGGCAGCGCCATGAGACTCCTCCCCCGCTTGCTG
HKR279349 ARiS198G05 pGCAP10 NM_003144.3  
GNAAGAGTAACGCCNTTACCNCCGGAGCCGCCGANAGCCTTAGCCGACGGAAACTGGACA
HKR363708 RBd09E12 pGCAP10 NM_003144.3  
GGCCATTACCGCCGGAGCCGCCGAGAGCCTTAGCCGACGGAAACTGGACACTGGACCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl