Prev. | 

RIKEN DNA Bank Human Resource - ITPRID2

Gene ID NCBI Gene 6744 |  KEGG hsa:6744
Gene Symbol ITPRID2
Protein Name ITPR interacting domain containing 2
Synonyms CS-1|CS1|KRAP|SPAG13|SSFA2
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013354 IRAK033G10 pBluescriptR BC028706 NM_006751 Full
HGY029418 IRAK073J02 pBluescriptR BC037334 NM_006751
HGY098929 IRAL047F09 pOTB7 BC052581 NM_006751 Full/var
HGY100281 IRAL050L17 pOTB7 BC064499 NM_006751 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE112438 M01C081B14 pDONR221 IMS04-D07 BC052581 ENST00000261006  
HGE112486 M01C081D14 pDONR221 IMS04-D07 BC052581 ENST00000261006  
HGE112534 M01C081F14 pDONR221 IMS04-D07 BC052581 ENST00000261006  
HGE112582 M01C081H14 pDONR221 IMS04-D07 BC052581 ENST00000261006  
HGE112630 M01C081J14 pDONR221 IMS04-D07 BC052581 ENST00000261006  
HGE112678 M01C081L14 pDONR221 IMS04-D07 BC052581 ENST00000261006  
HGE112726 M01C081N14 pDONR221 IMS04-D07 BC052581 ENST00000261006  
HGE112774 M01C081P14 pDONR221 IMS04-D07 BC052581 ENST00000261006  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR079330 ARe98F10 pKA1U5 NM_006751.5  
GCTCCTCCTCCGGCGCCCGCTTCAGCTCCCCGGGGCCCCCTGCCCGGCCGGGCGCTGACA
HKR375606 RBd39A06 pGCAP10 NM_006751.5  
TGGGGGCCCCCTGCCCGGCCGGGCGCTGACAGCAAGGGCGGGGGTCCCTGCCGCCGCCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl