Prev. |  KEGG KO K15409 > 

RIKEN DNA Bank Human Resource - SRPK1

Gene ID NCBI Gene 6732 |  KEGG hsa:6732
Gene Symbol SRPK1
Protein Name SRSF protein kinase 1
Synonyms SFRSK1
Ortholog resource in our bank

  SRPK1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013372 IRAK033H04 pBluescriptR BC038292 NM_003137 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE016137 W01A040F17 pENTR-TOPO IRAK033H04 BC038292 NM_003137  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR181281 ARi53D09 pGCAP10 NM_003137.3  
GGGTCTCACCATGGAGCGGAAAGTGCTTGCGCTCCAGGCCCGAAAGAAAAGGACCAAGGC
HKR362550 RBd06G06 pGCAP10 NM_003137.3  
GGCCACTCGAGTGCGCAGGCGCCTGGCGATTACCGGTCTCACCATGGAGCGGAAAGTGCT
HKR367235 RBd18B11 pGCAP10 NM_003137.3  
GACTCGAGTGCGCAGGCGCCTGGCGATTACCGGTCTCACCATGGAGCGGAAAGTGCTTGC
HKR462506 RBdS156E10 pGCAP10 NM_003137.3  
GACTCGAGTGCGCAGGCGCCTGGCGATTACCGGTCTCACCATGGAGCGGAAAGTGCTTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl